ID: 910790324

View in Genome Browser
Species Human (GRCh38)
Location 1:91043756-91043778
Sequence GACAGCTGTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910790321_910790324 11 Left 910790321 1:91043722-91043744 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910790324 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr