ID: 910790638

View in Genome Browser
Species Human (GRCh38)
Location 1:91046264-91046286
Sequence CTGCAGCAGTAGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910790631_910790638 21 Left 910790631 1:91046220-91046242 CCCTCTAGGGAACCCTGACTAAT 0: 74
1: 880
2: 1125
3: 752
4: 593
Right 910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG No data
910790634_910790638 8 Left 910790634 1:91046233-91046255 CCTGACTAATACATACACCTATA No data
Right 910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG No data
910790633_910790638 9 Left 910790633 1:91046232-91046254 CCCTGACTAATACATACACCTAT No data
Right 910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG No data
910790632_910790638 20 Left 910790632 1:91046221-91046243 CCTCTAGGGAACCCTGACTAATA 0: 70
1: 892
2: 1177
3: 821
4: 596
Right 910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG No data
910790636_910790638 -9 Left 910790636 1:91046250-91046272 CCTATAAAATGAGGCTGCAGCAG No data
Right 910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910790638 Original CRISPR CTGCAGCAGTAGATGGAGCC AGG Intergenic
No off target data available for this crispr