ID: 910792941

View in Genome Browser
Species Human (GRCh38)
Location 1:91069876-91069898
Sequence CTTGAAAGGCTGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910792941_910792948 -7 Left 910792941 1:91069876-91069898 CCTCCCACCTTCAGCCTTTCAAG No data
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910792941 Original CRISPR CTTGAAAGGCTGAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr