ID: 910792941 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:91069876-91069898 |
| Sequence | CTTGAAAGGCTGAAGGTGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910792941_910792948 | -7 | Left | 910792941 | 1:91069876-91069898 | CCTCCCACCTTCAGCCTTTCAAG | No data | ||
| Right | 910792948 | 1:91069892-91069914 | TTTCAAGTAGCTGGGACTACAGG | 0: 122 1: 3885 2: 56532 3: 177491 4: 237833 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910792941 | Original CRISPR | CTTGAAAGGCTGAAGGTGGG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||