ID: 910792948

View in Genome Browser
Species Human (GRCh38)
Location 1:91069892-91069914
Sequence TTTCAAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475863
Summary {0: 122, 1: 3885, 2: 56532, 3: 177491, 4: 237833}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910792941_910792948 -7 Left 910792941 1:91069876-91069898 CCTCCCACCTTCAGCCTTTCAAG No data
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833
910792940_910792948 9 Left 910792940 1:91069860-91069882 CCTAGGCTCAGATGATCCTCCCA 0: 90
1: 1640
2: 8600
3: 24275
4: 52341
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833
910792939_910792948 10 Left 910792939 1:91069859-91069881 CCCTAGGCTCAGATGATCCTCCC 0: 3
1: 114
2: 983
3: 2319
4: 3654
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833
910792938_910792948 19 Left 910792938 1:91069850-91069872 CCTCGACATCCCTAGGCTCAGAT No data
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833
910792942_910792948 -10 Left 910792942 1:91069879-91069901 CCCACCTTCAGCCTTTCAAGTAG No data
Right 910792948 1:91069892-91069914 TTTCAAGTAGCTGGGACTACAGG 0: 122
1: 3885
2: 56532
3: 177491
4: 237833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910792948 Original CRISPR TTTCAAGTAGCTGGGACTAC AGG Intergenic
Too many off-targets to display for this crispr