ID: 910795240

View in Genome Browser
Species Human (GRCh38)
Location 1:91091284-91091306
Sequence ATAAACCCCACGCTGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910795240_910795243 0 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG No data
910795240_910795242 -3 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795242 1:91091304-91091326 TATCACACCTAACAGTCTTAGGG No data
910795240_910795246 21 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795246 1:91091328-91091350 GGGAATGAGCCATACCAGAAAGG No data
910795240_910795244 1 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795244 1:91091308-91091330 ACACCTAACAGTCTTAGGGTGGG No data
910795240_910795241 -4 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795241 1:91091303-91091325 TTATCACACCTAACAGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910795240 Original CRISPR ATAAACCCCACGCTGAAATC TGG (reversed) Intergenic
No off target data available for this crispr