ID: 910795243

View in Genome Browser
Species Human (GRCh38)
Location 1:91091307-91091329
Sequence CACACCTAACAGTCTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910795240_910795243 0 Left 910795240 1:91091284-91091306 CCAGATTTCAGCGTGGGGTTTAT No data
Right 910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG No data
910795238_910795243 5 Left 910795238 1:91091279-91091301 CCACACCAGATTTCAGCGTGGGG No data
Right 910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910795243 Original CRISPR CACACCTAACAGTCTTAGGG TGG Intergenic
No off target data available for this crispr