ID: 910801255

View in Genome Browser
Species Human (GRCh38)
Location 1:91149060-91149082
Sequence AGGGGGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910801255_910801265 22 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801265 1:91149105-91149127 ATGTCACCCAGCCACTACCAGGG No data
910801255_910801268 28 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801268 1:91149111-91149133 CCCAGCCACTACCAGGGAGGTGG No data
910801255_910801264 21 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801255_910801266 25 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801255_910801271 30 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801271 1:91149113-91149135 CAGCCACTACCAGGGAGGTGGGG No data
910801255_910801270 29 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801270 1:91149112-91149134 CCAGCCACTACCAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910801255 Original CRISPR AGGGGGAGCACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr