ID: 910801264

View in Genome Browser
Species Human (GRCh38)
Location 1:91149104-91149126
Sequence CATGTCACCCAGCCACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910801261_910801264 -4 Left 910801261 1:91149085-91149107 CCCAAACTCAGAGATTCTCCATG No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801262_910801264 -5 Left 910801262 1:91149086-91149108 CCAAACTCAGAGATTCTCCATGT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801259_910801264 2 Left 910801259 1:91149079-91149101 CCCTTTCCCAAACTCAGAGATTC No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801258_910801264 3 Left 910801258 1:91149078-91149100 CCCCTTTCCCAAACTCAGAGATT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801255_910801264 21 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801256_910801264 20 Left 910801256 1:91149061-91149083 CCACAATCACTGTGCTCCCCCTT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801257_910801264 4 Left 910801257 1:91149077-91149099 CCCCCTTTCCCAAACTCAGAGAT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data
910801260_910801264 1 Left 910801260 1:91149080-91149102 CCTTTCCCAAACTCAGAGATTCT No data
Right 910801264 1:91149104-91149126 CATGTCACCCAGCCACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910801264 Original CRISPR CATGTCACCCAGCCACTACC AGG Intergenic
No off target data available for this crispr