ID: 910801266

View in Genome Browser
Species Human (GRCh38)
Location 1:91149108-91149130
Sequence TCACCCAGCCACTACCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910801256_910801266 24 Left 910801256 1:91149061-91149083 CCACAATCACTGTGCTCCCCCTT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801258_910801266 7 Left 910801258 1:91149078-91149100 CCCCTTTCCCAAACTCAGAGATT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801260_910801266 5 Left 910801260 1:91149080-91149102 CCTTTCCCAAACTCAGAGATTCT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801259_910801266 6 Left 910801259 1:91149079-91149101 CCCTTTCCCAAACTCAGAGATTC No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801255_910801266 25 Left 910801255 1:91149060-91149082 CCCACAATCACTGTGCTCCCCCT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801257_910801266 8 Left 910801257 1:91149077-91149099 CCCCCTTTCCCAAACTCAGAGAT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801262_910801266 -1 Left 910801262 1:91149086-91149108 CCAAACTCAGAGATTCTCCATGT No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data
910801261_910801266 0 Left 910801261 1:91149085-91149107 CCCAAACTCAGAGATTCTCCATG No data
Right 910801266 1:91149108-91149130 TCACCCAGCCACTACCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910801266 Original CRISPR TCACCCAGCCACTACCAGGG AGG Intergenic
No off target data available for this crispr