ID: 910802845

View in Genome Browser
Species Human (GRCh38)
Location 1:91162689-91162711
Sequence AAATGCTGGCCCTTCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910802845_910802849 11 Left 910802845 1:91162689-91162711 CCTGTGGTGAAGGGCCAGCATTT No data
Right 910802849 1:91162723-91162745 CTGACATTTTCTCACATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910802845 Original CRISPR AAATGCTGGCCCTTCACCAC AGG (reversed) Intergenic