ID: 910802849 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:91162723-91162745 |
Sequence | CTGACATTTTCTCACATACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910802845_910802849 | 11 | Left | 910802845 | 1:91162689-91162711 | CCTGTGGTGAAGGGCCAGCATTT | No data | ||
Right | 910802849 | 1:91162723-91162745 | CTGACATTTTCTCACATACTTGG | No data | ||||
910802847_910802849 | -3 | Left | 910802847 | 1:91162703-91162725 | CCAGCATTTGTATCATGGTCCTG | 0: 1 1: 0 2: 0 3: 12 4: 290 |
||
Right | 910802849 | 1:91162723-91162745 | CTGACATTTTCTCACATACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910802849 | Original CRISPR | CTGACATTTTCTCACATACT TGG | Intergenic | ||