ID: 910802849

View in Genome Browser
Species Human (GRCh38)
Location 1:91162723-91162745
Sequence CTGACATTTTCTCACATACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910802845_910802849 11 Left 910802845 1:91162689-91162711 CCTGTGGTGAAGGGCCAGCATTT No data
Right 910802849 1:91162723-91162745 CTGACATTTTCTCACATACTTGG No data
910802847_910802849 -3 Left 910802847 1:91162703-91162725 CCAGCATTTGTATCATGGTCCTG No data
Right 910802849 1:91162723-91162745 CTGACATTTTCTCACATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910802849 Original CRISPR CTGACATTTTCTCACATACT TGG Intergenic