ID: 910803561

View in Genome Browser
Species Human (GRCh38)
Location 1:91167979-91168001
Sequence GGTAGGTTGGTAGATGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910803551_910803561 21 Left 910803551 1:91167935-91167957 CCTCCCTCTACTAAACCATGAGG No data
Right 910803561 1:91167979-91168001 GGTAGGTTGGTAGATGCTCCAGG No data
910803554_910803561 17 Left 910803554 1:91167939-91167961 CCTCTACTAAACCATGAGGTTCT No data
Right 910803561 1:91167979-91168001 GGTAGGTTGGTAGATGCTCCAGG No data
910803556_910803561 6 Left 910803556 1:91167950-91167972 CCATGAGGTTCTTAGTGGCACAG No data
Right 910803561 1:91167979-91168001 GGTAGGTTGGTAGATGCTCCAGG No data
910803553_910803561 18 Left 910803553 1:91167938-91167960 CCCTCTACTAAACCATGAGGTTC No data
Right 910803561 1:91167979-91168001 GGTAGGTTGGTAGATGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910803561 Original CRISPR GGTAGGTTGGTAGATGCTCC AGG Intergenic
No off target data available for this crispr