ID: 910810051

View in Genome Browser
Species Human (GRCh38)
Location 1:91226799-91226821
Sequence GTTTTTAAGGGTAATTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910810051_910810058 1 Left 910810051 1:91226799-91226821 CCCTCCAAATTACCCTTAAAAAC No data
Right 910810058 1:91226823-91226845 CTGATCTCCGAATGTTCCAGGGG No data
910810051_910810061 29 Left 910810051 1:91226799-91226821 CCCTCCAAATTACCCTTAAAAAC No data
Right 910810061 1:91226851-91226873 TTTGAGTAATAATAAGACTCCGG 0: 7
1: 269
2: 325
3: 195
4: 232
910810051_910810056 -1 Left 910810051 1:91226799-91226821 CCCTCCAAATTACCCTTAAAAAC No data
Right 910810056 1:91226821-91226843 CTCTGATCTCCGAATGTTCCAGG No data
910810051_910810057 0 Left 910810051 1:91226799-91226821 CCCTCCAAATTACCCTTAAAAAC No data
Right 910810057 1:91226822-91226844 TCTGATCTCCGAATGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910810051 Original CRISPR GTTTTTAAGGGTAATTTGGA GGG (reversed) Intergenic
No off target data available for this crispr