ID: 910810942

View in Genome Browser
Species Human (GRCh38)
Location 1:91235730-91235752
Sequence GAGACGTGACCATGGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910810942_910810947 22 Left 910810942 1:91235730-91235752 CCTCTGCTCCATGGTCACGTCTC No data
Right 910810947 1:91235775-91235797 GCCTCCCTCCTTCACTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910810942 Original CRISPR GAGACGTGACCATGGAGCAG AGG (reversed) Intergenic
No off target data available for this crispr