ID: 910812889

View in Genome Browser
Species Human (GRCh38)
Location 1:91255778-91255800
Sequence AAAATACCGCGGCAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910812883_910812889 9 Left 910812883 1:91255746-91255768 CCGGGCCAACATAGTGAAGCCCA No data
Right 910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG No data
910812881_910812889 27 Left 910812881 1:91255728-91255750 CCGGGAGTTTGAGAACAGCCGGG No data
Right 910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG No data
910812884_910812889 4 Left 910812884 1:91255751-91255773 CCAACATAGTGAAGCCCATCTCT No data
Right 910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG No data
910812885_910812889 -10 Left 910812885 1:91255765-91255787 CCCATCTCTACTAAAAATACCGC No data
Right 910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910812889 Original CRISPR AAAATACCGCGGCAGGAGAA TGG Intergenic
No off target data available for this crispr