ID: 910814861

View in Genome Browser
Species Human (GRCh38)
Location 1:91280923-91280945
Sequence TACCACTACATTGCTGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910814856_910814861 18 Left 910814856 1:91280882-91280904 CCAGCCAAATCTACAGAAGTGAG No data
Right 910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 139
910814855_910814861 23 Left 910814855 1:91280877-91280899 CCTTACCAGCCAAATCTACAGAA No data
Right 910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 139
910814858_910814861 14 Left 910814858 1:91280886-91280908 CCAAATCTACAGAAGTGAGGCAA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910814861 Original CRISPR TACCACTACATTGCTGCTTA GGG Intronic
902005555 1:13229222-13229244 TACCACTCCATCTCTGCTTCTGG + Intergenic
906029741 1:42709064-42709086 TACCAATACCTTGCTGTTTTTGG + Intergenic
908064772 1:60390944-60390966 TACCATCACATTGATGATTAGGG - Intergenic
908804280 1:67914108-67914130 TACCACTACATTAGGGATTAGGG - Intergenic
910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG + Intronic
915718652 1:157967345-157967367 TACCATTACATTGGGGATTAGGG - Intergenic
921798477 1:219375052-219375074 TACCATTACATAGCTGTTCAAGG + Intergenic
921847345 1:219898231-219898253 TACCACTAGAATGCTGCTATAGG + Intronic
1063908827 10:10809022-10809044 TACCACCACATTGGGGGTTAGGG - Intergenic
1066616581 10:37301224-37301246 TACCATCACATTGGTGGTTAGGG - Intronic
1068586750 10:58808755-58808777 TGCCACTGCACTGCAGCTTAGGG - Intronic
1069118656 10:64539745-64539767 TACCACTTCCTGGCTGCTGAAGG + Intergenic
1071209983 10:83329967-83329989 GCCCTCTACATTGCTGCTCAAGG + Intergenic
1072208076 10:93221879-93221901 CACCATTAAATCGCTGCTTATGG + Intergenic
1076817770 10:132923152-132923174 TACCCCTACATGGCTGCTCAAGG - Intronic
1080047637 11:27826374-27826396 TACCACTGGATTGCTGCTTTAGG + Intergenic
1082584471 11:54918344-54918366 AACCACTACAGAGATGCTTAAGG - Intergenic
1086606702 11:88704209-88704231 TACCATCACATTGGGGCTTAGGG + Intronic
1089246498 11:117124617-117124639 TACCATTACATTGAGGGTTAAGG + Intergenic
1092661113 12:10739483-10739505 TACCATCACATTGATGGTTAGGG - Intergenic
1093829061 12:23733238-23733260 GACTACCACATTGCTGATTATGG + Intronic
1094398435 12:30034336-30034358 TTCCACTACATTGTTGCTAGTGG + Intergenic
1094500530 12:31017100-31017122 TACCATTACATTGGTGGTTAGGG - Intergenic
1094727109 12:33131647-33131669 TACCACTACATTGCTAGTGCTGG - Intergenic
1096516661 12:52159841-52159863 TACCACTGCATTTCAGCCTAGGG - Intergenic
1096658642 12:53107258-53107280 TTCCACTCCACTGCTGCTTTTGG - Intronic
1097551059 12:61070168-61070190 CACCACTACATTTTTTCTTAAGG - Intergenic
1099956544 12:89356412-89356434 CACCACTTCATTCCTGCATAAGG + Intergenic
1102485097 12:113250176-113250198 AAACACTTCCTTGCTGCTTAGGG - Intronic
1103587926 12:121969957-121969979 TATCACTTCATTGCTGCTTCTGG + Intronic
1104146603 12:126040110-126040132 GACCACTACATTGCTGGTCCTGG + Intergenic
1108077674 13:46698426-46698448 TGTCACTACATTGCCGCTTTGGG + Intronic
1109787579 13:67200316-67200338 TACCTCTACACTGCTGTGTAGGG - Intronic
1111848073 13:93536550-93536572 TAGCACTGCATTGCTTTTTATGG + Intronic
1111996844 13:95173764-95173786 TACCATTACATTGGTGATTAGGG - Intronic
1118148030 14:63161980-63162002 TACCATTACATTGGTGATTATGG - Intergenic
1118504760 14:66399149-66399171 TGCCACTACACAGCTGCTTACGG + Intergenic
1118655195 14:67939816-67939838 TACCATTACATTGGGGATTAGGG + Intronic
1118928057 14:70212185-70212207 TACCATCACATTGCAGATTAAGG - Intergenic
1122258307 14:100496875-100496897 TACCACTACACTCCAGCCTAAGG - Intronic
1124405359 15:29386627-29386649 TACCATTACATTGCGGGTTAGGG - Intronic
1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG + Intergenic
1127316531 15:57799894-57799916 TATCACTACATTGTTTATTAAGG - Intergenic
1127426020 15:58857613-58857635 CACCACTTCATTGCTGGTTTGGG + Exonic
1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG + Intronic
1131984321 15:98026025-98026047 TAGCACAACACTGCTTCTTATGG - Intergenic
1132025232 15:98399510-98399532 TACCATTACATTGGGGGTTAAGG - Intergenic
1134867755 16:17623808-17623830 TACCATCACATTGCTAATTAGGG - Intergenic
1135478117 16:22795629-22795651 TGGCATTACCTTGCTGCTTAAGG + Intergenic
1135612271 16:23878870-23878892 CAACACTACATTGCCTCTTAAGG - Intronic
1139606219 16:68020589-68020611 TACCACTACACTCCAGCCTAGGG - Intronic
1144003400 17:11076414-11076436 TACCATCACATTGGTGGTTAGGG + Intergenic
1147491504 17:40871576-40871598 TACCACAACCTTGCTGCTGGCGG + Intergenic
1153637869 18:7128626-7128648 TCCCACTCTATTGCTACTTAGGG - Intergenic
1155650478 18:28134667-28134689 TACCACTGCACTGCAGCTTGGGG + Intronic
1157409755 18:47453958-47453980 CACCCCAACATTGCTACTTAGGG + Intergenic
1157884813 18:51356836-51356858 TACCATCACATTGGTGATTAAGG - Intergenic
1162283678 19:9720943-9720965 TACCACTACACATCTGCTTGGGG - Intergenic
1163877338 19:19883531-19883553 TGCCACTACATTGCAGGTTGGGG + Intronic
1164048120 19:21560232-21560254 TACCAGTACCATGCTGCTTTGGG - Intergenic
925715339 2:6779730-6779752 TACCACGACATTGGGGGTTAGGG + Intergenic
928696305 2:33853305-33853327 TAGCCCTACATTTCTCCTTAGGG + Intergenic
930160159 2:48146605-48146627 TACCACTGCACTCCAGCTTAGGG - Intergenic
930313465 2:49770875-49770897 TACCATTACATTGGGGCTTAGGG - Intergenic
932053414 2:68421079-68421101 AACCTCTATCTTGCTGCTTAAGG + Intergenic
932745039 2:74326899-74326921 CACCACCACCTTGCTGCTTTGGG - Intronic
936814059 2:116437792-116437814 TAACACTACATTGGTGTTCATGG + Intergenic
937030983 2:118740303-118740325 TACCACAACATTGTGGGTTAGGG - Intergenic
937735646 2:125284862-125284884 TTCCACTGCAATGCTGCATAAGG + Intergenic
937999491 2:127720604-127720626 TACCACTGCATTCCAGCTTGGGG - Intronic
942552520 2:177134253-177134275 CACCACTAAATTGGTGATTAAGG + Intergenic
944799290 2:203221820-203221842 TAACACTATATTGTTGCCTAAGG - Intronic
945631664 2:212286181-212286203 TACTATTACATTGGTTCTTACGG + Intronic
946929665 2:224659359-224659381 TACCATTACATTGGAGATTAGGG - Intergenic
947679230 2:232014620-232014642 TACCACTAGACTGCTTCTTTGGG - Intronic
947775081 2:232702103-232702125 TACCACTACACTCCAGCTGAGGG + Intronic
1168738879 20:170968-170990 TACCACTATATTTTTGCTCATGG + Intergenic
1169465551 20:5835162-5835184 TACCTCTACACTGCTGGCTAGGG + Intronic
1170326924 20:15166248-15166270 TACCATTACATTGGGGCTTAAGG - Intronic
1177248827 21:18566695-18566717 TACTGCTACACTGCTGCTTGTGG + Intergenic
1177748677 21:25253212-25253234 TACCACCATATTGCAGGTTAGGG - Intergenic
1177888766 21:26779181-26779203 TACCATTACATTGGTGATGATGG - Intergenic
1178837183 21:36108548-36108570 TACCACTACACATCTGCTCAGGG - Intergenic
1179060040 21:37971468-37971490 TAACACTTCAATGATGCTTAAGG - Intronic
1179251952 21:39678060-39678082 TACCATTACACTACTGATTAGGG - Intergenic
951460634 3:22947737-22947759 TACCACCACATTCCTGATGAAGG - Intergenic
955292193 3:57702465-57702487 TACCATCACATTGCGGGTTAGGG - Intergenic
956156899 3:66307872-66307894 TACCAGTACCCTGCTGTTTAGGG + Intronic
958613224 3:96454207-96454229 TACCACTGCACTCCTGCTTGGGG + Intergenic
960694090 3:120378685-120378707 TACCACTAAATTAGTGCTCAGGG - Intergenic
965325187 3:167294315-167294337 TACCAGTACAATGCTGTTTTGGG - Intronic
965393460 3:168133057-168133079 TACCAGTACAATGCTGTTTTGGG - Intergenic
970836939 4:20420723-20420745 TACCACTGCATTGGAGGTTAGGG - Intronic
971343062 4:25788291-25788313 TACCACTCAATTGCTGCTTCGGG + Exonic
973668560 4:53189664-53189686 TACCATCACATTGGAGCTTAGGG + Intronic
973755294 4:54067947-54067969 TACCATTACATTGAGGGTTAGGG - Intronic
974129109 4:57730943-57730965 TACCATAATACTGCTGCTTAGGG - Intergenic
975489666 4:74974722-74974744 TACCATCACATTGAAGCTTAAGG - Intronic
976336698 4:83896020-83896042 TACCATTACATTGAGGATTAGGG + Intergenic
977975342 4:103257876-103257898 TACCACTACATAGCAGTATATGG - Intergenic
978522191 4:109628218-109628240 TACAATTTCATTGCTGCTTGTGG - Intronic
979557775 4:122069675-122069697 TTTCAGTACATTGTTGCTTATGG + Intergenic
982445589 4:155487025-155487047 TACCATTACATTGGGGGTTAGGG - Intergenic
983844541 4:172500650-172500672 TACCATTACAGAGCAGCTTAAGG + Intronic
984428157 4:179614401-179614423 TATCATCACATTGCAGCTTAGGG - Intergenic
987803412 5:22728874-22728896 TACCATACCATTGATGCTTAGGG + Intronic
988005024 5:25399260-25399282 TTCCACCACATTGGTGGTTAAGG + Intergenic
991124537 5:63054410-63054432 TACTGCTACATTGGGGCTTAGGG - Intergenic
992164720 5:74038352-74038374 TACCACTACACTGGGGGTTAAGG - Intergenic
995815716 5:116165845-116165867 TGCAACTACACTGCTGTTTAGGG + Intronic
997291806 5:132742414-132742436 TACCATCACATTGCAGGTTAGGG + Intergenic
999031660 5:148299927-148299949 TACCACTACCTGGCTGGTCACGG + Intergenic
1000155639 5:158548871-158548893 TACCACTACCTTGCTGTTTTGGG + Intergenic
1000172932 5:158721632-158721654 TACAACTATATTATTGCTTACGG - Intronic
1001218080 5:169874557-169874579 TACCACTACATTCCCACTTCAGG - Intronic
1002086537 5:176779401-176779423 TACCAAAACATTGCTTTTTACGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1009895808 6:69747095-69747117 TACCATTACATTGGGGGTTAGGG - Intronic
1014271591 6:119342617-119342639 AACCACTACATTGCTTCAAATGG + Intronic
1015870425 6:137770565-137770587 AACCACCACATTGGTGATTAGGG + Intergenic
1016917207 6:149255102-149255124 TACCATTACATTGGGGGTTAGGG - Intronic
1018512867 6:164544893-164544915 TACAACTACATTGTTATTTATGG - Intergenic
1022876347 7:34535411-34535433 TATCTGTACATTTCTGCTTAGGG + Intergenic
1022945027 7:35274599-35274621 TACCAATACAATGCTGCTTTTGG - Intergenic
1023192373 7:37596464-37596486 TACCATCACATTGCAGATTAGGG + Intergenic
1030218147 7:107067730-107067752 GACTACTACAATGCTCCTTATGG - Intronic
1030800003 7:113837956-113837978 TACCATCACATTGGTGGTTAGGG + Intergenic
1031006794 7:116482590-116482612 TACCATTACATTGGGGGTTAAGG + Intronic
1031714863 7:125096410-125096432 TACCAATACATTGGGGGTTAGGG + Intergenic
1034053195 7:148005343-148005365 TGCCATTACATTGGTGATTAGGG + Intronic
1034909376 7:154981240-154981262 TGCCAGTACAGTGCTGCTTGCGG - Intronic
1035549021 8:505951-505973 TCCCACTACCCTGCTGCTTAGGG - Intronic
1035996097 8:4549206-4549228 TAACATTACATTGCTGCCAATGG - Intronic
1038115976 8:24555661-24555683 TACCATCACATTGCAGGTTAGGG - Intergenic
1043281751 8:78476442-78476464 TACCATTACATTGGGGATTAGGG + Intergenic
1043532074 8:81161803-81161825 TACCAGCACATTGCAGGTTAGGG + Intergenic
1047981542 8:130188354-130188376 TATCACTACTTTGCAGCTGAGGG + Intronic
1051708275 9:19903444-19903466 TACCACCACATTGGGGATTAAGG + Intergenic
1052388267 9:27847956-27847978 TACGACTGCCTTGCTGGTTATGG + Intergenic
1058862430 9:109129004-109129026 TACCACCACATTGGGGATTAGGG + Intergenic
1185818685 X:3181216-3181238 CACCACTGCACTCCTGCTTAGGG + Intergenic
1187371630 X:18713442-18713464 TACTGCTCCATTGCTCCTTATGG + Intronic
1190256672 X:48768173-48768195 TAATACTACATTTCTGCATAAGG - Intronic
1190961681 X:55255972-55255994 AACCACCACAGGGCTGCTTAGGG + Intronic
1192681505 X:73258336-73258358 TACCACCACATATCTGCTTGAGG + Intergenic
1192978122 X:76307653-76307675 TACCTCTTCAGTGCTGCTTTTGG + Intergenic
1194362660 X:92973605-92973627 TACCAGTACATTGCCGATTTTGG - Intergenic
1194973445 X:100369255-100369277 TACCACTACAAAGCTGCTAAGGG + Intronic
1195251756 X:103054713-103054735 TACCATTACATTGGGGATTAGGG - Intergenic
1195909062 X:109871057-109871079 TACAACTACATGGTTGCTGAGGG - Intergenic
1196929497 X:120667275-120667297 TACCAATGCACTGTTGCTTAAGG + Intergenic
1198742556 X:139856446-139856468 TACCACTACACATCTGCTCAGGG - Intronic
1200656503 Y:5909446-5909468 TACCACCACACTGCTGCTGTTGG - Intergenic
1200670911 Y:6089839-6089861 TACCAGTACATTGCCGATTTTGG - Intergenic
1201861043 Y:18597467-18597489 TACCATTGCATTGCTGGGTAGGG + Intergenic
1201872280 Y:18722913-18722935 TACCATTGCATTGCTGGGTAGGG - Intergenic