ID: 910819390

View in Genome Browser
Species Human (GRCh38)
Location 1:91329490-91329512
Sequence GCAGCAAGGAAGTTTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910819383_910819390 3 Left 910819383 1:91329464-91329486 CCACTAAGAAGAAGGCAAAGACT 0: 2
1: 0
2: 0
3: 23
4: 291
Right 910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG 0: 1
1: 1
2: 1
3: 22
4: 251
910819381_910819390 19 Left 910819381 1:91329448-91329470 CCAGAATCAAAGGGATCCACTAA 0: 1
1: 0
2: 2
3: 3
4: 98
Right 910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG 0: 1
1: 1
2: 1
3: 22
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910819390 Original CRISPR GCAGCAAGGAAGTTTAAAAG GGG Intronic
903697730 1:25220725-25220747 ACAGCAAGTAAGGGTAAAAGAGG + Intergenic
903761899 1:25704191-25704213 GCAGGAAGGAAGTTTAATAAAGG - Intronic
905831801 1:41075204-41075226 GCAGCAAGGTAGGTAAAATGTGG - Exonic
905881153 1:41464646-41464668 GAAGCAATGAAGGTTAAATGAGG + Intergenic
906369928 1:45244656-45244678 GAAGCAAGGGAGATGAAAAGAGG + Intronic
910739855 1:90503208-90503230 GGAGGAGTGAAGTTTAAAAGGGG + Intergenic
910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG + Intronic
911089720 1:94008941-94008963 GAAGCAAGGAAGTGGAAGAGAGG - Intronic
912163485 1:107014113-107014135 GAAGAAAAGAATTTTAAAAGTGG + Intergenic
913657251 1:120973006-120973028 GCAGGAAGGAAGGTTACAACTGG + Intergenic
914008594 1:143756091-143756113 GCAGGAAGGAAGGTTACAACGGG + Intergenic
914521806 1:148424285-148424307 GCAGGAAGGAAGGTTACAACTGG + Intergenic
914647224 1:149664742-149664764 GCAGGAAGGAAGGTTACAACTGG + Intergenic
917259746 1:173154209-173154231 GCAGCCAGGAAGTTCAAACTGGG + Intergenic
921769954 1:219024385-219024407 GCAACAAAAAAGTTGAAAAGTGG + Intergenic
923434965 1:233959476-233959498 GCAGCAAACAATATTAAAAGAGG + Intronic
923886403 1:238162506-238162528 GGAACAAAAAAGTTTAAAAGTGG - Intergenic
1065332208 10:24614142-24614164 GCAGCAAGGGAGTAGAAATGTGG + Intronic
1065957361 10:30705436-30705458 ACAGCAAGGAGGCTGAAAAGAGG - Intergenic
1066201607 10:33147191-33147213 GCTGAAAGGAAGGATAAAAGAGG - Intergenic
1067189058 10:44054529-44054551 GCACCATGGGAGTTTGAAAGTGG + Intergenic
1067210609 10:44257984-44258006 GGAGAAAGGAAGATTCAAAGTGG - Intergenic
1067340759 10:45401515-45401537 GCAGCAAGGAGGATGCAAAGTGG - Intronic
1070152473 10:73813397-73813419 GCAGCAAGGAAGAATAAGAAGGG + Exonic
1077770349 11:5211381-5211403 GGAGCAAGGAAGAATAAAATGGG + Intergenic
1078682390 11:13489047-13489069 ACAGAAAGGATTTTTAAAAGTGG - Intergenic
1080260941 11:30349310-30349332 GAAGCAAGGAAGCAAAAAAGGGG - Intergenic
1080489458 11:32747585-32747607 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1081080190 11:38731856-38731878 GCAGCTGGGAAGTTCAAAATGGG - Intergenic
1081163233 11:39777252-39777274 CCAGGACAGAAGTTTAAAAGAGG - Intergenic
1083123820 11:60543073-60543095 GCAGAAAGGAACTTTAAATAAGG - Intergenic
1083313198 11:61796475-61796497 GCAGCAGGGAAGTTTAAAAGGGG + Exonic
1085178730 11:74513666-74513688 ACAACAAAAAAGTTTAAAAGTGG + Intronic
1088483438 11:110318487-110318509 GTAGCATGGAAGTTAAATAGTGG - Intergenic
1089074936 11:115730410-115730432 GGAGTAAGGAAGATAAAAAGAGG - Intergenic
1090079878 11:123605091-123605113 GCAGCCAGGAATTTTACATGGGG + Intronic
1090619312 11:128547693-128547715 ATAGCAAGAAAGTTTGAAAGAGG + Intronic
1090819463 11:130328166-130328188 GCAGCAAGGATGATTAACAAAGG - Intergenic
1091967917 12:4761164-4761186 GCAGCACGGAAGAATGAAAGAGG + Intronic
1092074032 12:5658077-5658099 CCAGCAAGGAAGAAGAAAAGGGG - Intronic
1092673902 12:10895094-10895116 GCCGCAACGAAGTCTAGAAGAGG + Intronic
1092961381 12:13599471-13599493 GCAGCATGGAAATTTATATGTGG - Intronic
1093278504 12:17159884-17159906 GAAGCAGGGAAGTTGAAAGGGGG - Intergenic
1093642258 12:21541335-21541357 GCAGCAAGAAAAGTTAAAATGGG - Intronic
1093791088 12:23251006-23251028 GCAGAAAGGAATTGTAAAAAAGG - Intergenic
1093814867 12:23533577-23533599 ATAGCAAGGAAGTTAAAAACAGG + Exonic
1093914504 12:24786385-24786407 GCAGAAAGGAGGTTTATTAGAGG - Intergenic
1093959508 12:25256792-25256814 GCAGCGAAGAAGTTGAGAAGTGG - Intergenic
1094733102 12:33200629-33200651 GCAGCCAGGAAGTTTGAACTTGG - Intergenic
1094838174 12:34331918-34331940 GCAGCAGGGAGGCTTGAAAGGGG + Intergenic
1094838625 12:34333803-34333825 GCAGCAGGGAGGTTGTAAAGGGG + Intergenic
1094839067 12:34335392-34335414 GCATCACGGAAGCTTGAAAGCGG + Intergenic
1094839401 12:34336646-34336668 GCGGCAGGGAAGCTTGAAAGGGG + Intergenic
1094840736 12:34341686-34341708 GCAGCAAGGAGGCTTGAAATGGG + Intergenic
1094841789 12:34345381-34345403 GCAGCAGGGAGGCTTGAAAGGGG - Intergenic
1094843968 12:34353442-34353464 GCAGCAGGGAGGCTTGAAAGGGG - Intergenic
1094844330 12:34354863-34354885 GCGGCAGGGAAGCTTGAAAGGGG - Intergenic
1094844563 12:34355798-34355820 GCAGCAGGGAGGCTTGAAAGGGG - Intergenic
1094850740 12:34381281-34381303 GCAGCAGGGAGGCTTGAAAGGGG - Intergenic
1094870821 12:34598353-34598375 GCAGCAGGAATGTTTGAAAGGGG + Intergenic
1094871459 12:34601348-34601370 GCAGCAGGAAGGTTTGAAAGGGG + Intergenic
1097635178 12:62113756-62113778 GCCGCCAGGAAGTTTAAACTGGG - Intronic
1098704616 12:73671780-73671802 GCAGCCAGGAAGTTTGAAATGGG + Intergenic
1099607651 12:84826171-84826193 ACAGGAAAGAAGTTTGAAAGTGG + Intergenic
1100712486 12:97273349-97273371 GAAGCAAGTAAGTCTGAAAGTGG - Intergenic
1100790469 12:98124767-98124789 ACAGCAAGTAGGTTTAAAAAGGG + Intergenic
1101128281 12:101662016-101662038 CCAGCAAGGAAGATAAGAAGAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1107060795 13:36157618-36157640 GGAGGAAGGAAGGTTACAAGAGG - Intergenic
1107312304 13:39092579-39092601 GTAGCAAAGAAGCTTCAAAGTGG + Intergenic
1107551984 13:41485443-41485465 GCAACAACGAAGTTTAAAAGTGG - Intergenic
1108329273 13:49368991-49369013 TCAGCAACGAAATTAAAAAGGGG + Intronic
1108371189 13:49770478-49770500 CCATCAAGGAAGTAGAAAAGTGG - Intronic
1110183734 13:72647956-72647978 GCAGAAAGTAAGTTTCAGAGAGG - Intergenic
1110242969 13:73289088-73289110 ACAGCAAAGAGGATTAAAAGTGG + Intergenic
1112638692 13:101246995-101247017 GCAGGAAGGAATTCTAAACGAGG + Intronic
1113290130 13:108896653-108896675 GATGCCAGGAAATTTAAAAGTGG + Intronic
1114964382 14:27939422-27939444 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
1115598876 14:34936433-34936455 ACAGCAAGGAACTCTACAAGTGG - Intergenic
1116076891 14:40122140-40122162 GCAGGAAGGAATATTGAAAGAGG + Intergenic
1116268215 14:42724242-42724264 GAAGCAAGGAAGCTTAAAGGGGG + Intergenic
1116915978 14:50526163-50526185 GAACCAAGGAAGATTAACAGAGG - Intronic
1117196843 14:53348705-53348727 GCAGAAAGGAAGCTTAACTGAGG - Intergenic
1117541611 14:56752426-56752448 GAGCCAAGGAATTTTAAAAGGGG - Intergenic
1117658072 14:57976780-57976802 TCAGTAAGGAAGATCAAAAGAGG + Intronic
1118056561 14:62085231-62085253 GCAGCAAAAAAGCTTGAAAGGGG + Intronic
1118633508 14:67726946-67726968 CCAGCAGGGAAGATTGAAAGTGG - Intronic
1118876929 14:69793763-69793785 GCAGCAAGGATGGTCAAAAGAGG + Intronic
1121498674 14:94416140-94416162 GCTATAAGGAAGATTAAAAGTGG - Intergenic
1122445438 14:101764052-101764074 GAAGCAAAGAAATTTACAAGTGG - Intronic
1122575671 14:102739954-102739976 GGAGGAAGGAAGTATACAAGGGG + Intergenic
1125482931 15:40092963-40092985 TCAGCAAGCAAGTTTACATGAGG + Intronic
1127743372 15:61937418-61937440 GCAGCAAGACAGCTTGAAAGTGG - Intronic
1127807969 15:62538578-62538600 GGAGGAAGGATGTTTGAAAGGGG - Intronic
1132384503 15:101390506-101390528 GCAGCAAGGCTGTTTGAGAGAGG + Intronic
1132794414 16:1712385-1712407 GCAGCAAAGGAGATGAAAAGTGG - Intronic
1136726241 16:32359865-32359887 GAAGCAAGGAATTTAAAAGGGGG + Intergenic
1138321463 16:56116957-56116979 GCAGGAACAAAGTTTAAAACAGG + Intergenic
1140668017 16:77245476-77245498 GTAGCAATGCAGTTTGAAAGAGG + Intergenic
1140962688 16:79931770-79931792 GCAGCATGGAGGTTTAGAAAGGG - Intergenic
1203000191 16_KI270728v1_random:157891-157913 GAAGCAAGGAATTTAAAAGGGGG - Intergenic
1203131792 16_KI270728v1_random:1694294-1694316 GAAGCAAGGAATTTAAAAGGGGG - Intergenic
1148224805 17:45891855-45891877 GCGGAAAGGAAGAGTAAAAGTGG + Intergenic
1149157762 17:53653509-53653531 TGATCAAGGAAGTTTAACAGAGG + Intergenic
1150630635 17:66877933-66877955 GCAGAAATGAAGATTCAAAGAGG + Intronic
1150785879 17:68162352-68162374 GCAGAAAGAAAGTTTACAAGGGG + Intergenic
1153356319 18:4140436-4140458 GAAACAAGAAAATTTAAAAGTGG - Intronic
1153555269 18:6306166-6306188 GCAAAAAAGAAGTTGAAAAGTGG - Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155080542 18:22406205-22406227 GCTGCCAGGAAGTTTAAACTGGG + Intergenic
1155160837 18:23194272-23194294 GAAGCAAGGAAGCTTAAAAAAGG - Intronic
1158626657 18:59077570-59077592 GGACTAAGGAAGCTTAAAAGAGG + Intergenic
1158723342 18:59945675-59945697 GCAGCAATGAAGTTAAACACTGG - Intergenic
1159140478 18:64388568-64388590 GCATTAAGGAAGGGTAAAAGTGG - Intergenic
1161932563 19:7350420-7350442 ACAGCAAGGGAGTTGAAATGTGG - Intronic
1164177613 19:22789993-22790015 GAAGTCAGAAAGTTTAAAAGTGG - Intergenic
1164879360 19:31718202-31718224 GCAGCTTGGCAGTTTAAAATTGG - Intergenic
1165280277 19:34791656-34791678 GTAGCAGGGAAGTGTATAAGGGG + Intergenic
1166749447 19:45158031-45158053 GAAACATGGAAATTTAAAAGTGG - Intronic
1167202749 19:48077789-48077811 GCTGCAAGAAAGTTCACAAGGGG - Exonic
1167771441 19:51522453-51522475 GCAGAAAAGAAGATTAAAAACGG + Intronic
1168352075 19:55681655-55681677 GCAGAAATAAAGTTTAAAACAGG - Intronic
926630244 2:15129229-15129251 GCAACAGGGGAGTTTAAAGGAGG - Intergenic
927570836 2:24158247-24158269 TCAGAGAGGAAGTTTTAAAGCGG - Intronic
929088157 2:38189093-38189115 ACAGAAAGGAAGTATAAAATTGG - Intergenic
929191874 2:39147617-39147639 ACAGCAATAAAGTTTTAAAGAGG + Intergenic
929315008 2:40466371-40466393 GCAGCAAAGAAGCTTCACAGGGG + Intronic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
934865391 2:97805286-97805308 ACAGCAATGTACTTTAAAAGTGG + Intronic
938718481 2:134043234-134043256 GCAGCCAGGAAGCTCAAAATGGG + Intergenic
939378710 2:141405802-141405824 GCAGCAGGGAAATTAAAAACTGG - Intronic
939563888 2:143764418-143764440 GAACCAAGGAAGTTTGAAAGGGG - Intronic
939872927 2:147545069-147545091 GGAGCAAGGAAGATTAAATATGG + Intergenic
941570762 2:167167094-167167116 ACAGCAAGGTAATTTATAAGGGG - Intronic
942462702 2:176179257-176179279 GCAGCAAAAAAGGGTAAAAGGGG - Intergenic
942956912 2:181783971-181783993 ACAGCAGGGAAGTTAAAGAGAGG + Intergenic
943172711 2:184424193-184424215 GCAGCAAGCAGGTCCAAAAGTGG - Intergenic
945637714 2:212377558-212377580 GCAGCAAGGATGATAAAAAATGG + Intronic
948377673 2:237532397-237532419 GTAGGAAGGAAGTTTCTAAGGGG + Intronic
948968070 2:241400211-241400233 GCAGCCAGGTAGTTGAAAAAGGG + Intronic
1169510048 20:6254379-6254401 GGGGAAAAGAAGTTTAAAAGTGG - Intergenic
1171046977 20:21818121-21818143 GAAGCAAGGAAATTTAGAGGGGG - Intergenic
1171185180 20:23119850-23119872 ACAGGAAGGAAGCTTAAAATGGG - Intergenic
1171237969 20:23543395-23543417 CCAGAAAGGCAGTTGAAAAGTGG - Intergenic
1173050936 20:39561139-39561161 ACAGCAAGGAAGTTGAAGAGGGG - Intergenic
1173318061 20:41962691-41962713 GCAAAATGGAAGTGTAAAAGGGG + Intergenic
1174623542 20:51895535-51895557 GCAGCAATGAAATTTAAATGAGG - Intergenic
1175167763 20:57057399-57057421 GCAGTAAAGTAGTTTAAAATTGG - Intergenic
1179225627 21:39450573-39450595 GCAGCAGGGGATTTTAAAAAGGG + Intronic
1180933861 22:19611371-19611393 GCAGCAACCAAGTTGAAGAGAGG + Intergenic
1181538015 22:23556722-23556744 GCAGCAAGGAAGTGGCAGAGTGG + Intergenic
1182839535 22:33376899-33376921 GCAATAAGGAAGTTTAAGTGGGG - Intronic
1183397369 22:37579759-37579781 GCAGCAAAGAAGTTGGACAGAGG - Intronic
949288029 3:2429730-2429752 GCAGCAAGGAAGCTCAAACTGGG - Intronic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951284864 3:20798109-20798131 AAATCAAGGAATTTTAAAAGTGG - Intergenic
951463641 3:22977993-22978015 GGAGCATGGGAGGTTAAAAGTGG - Intergenic
952432765 3:33240348-33240370 GAAGCAAGAGAGTTTAGAAGTGG + Intergenic
953090187 3:39716916-39716938 GCAGCAAAGGAATTTTAAAGAGG + Intergenic
955952816 3:64259410-64259432 GCAGCAAGGGTGTTTAAACCAGG - Intronic
956744735 3:72302217-72302239 GCAGCAAGGCAGAAAAAAAGGGG - Intergenic
958094917 3:88931373-88931395 GAAGGAAGGAAGTTTAAAAAGGG - Intergenic
958185146 3:90110638-90110660 GCAGCCAGGAAGCTTGAAATGGG - Intergenic
960084685 3:113577998-113578020 ACAGACAGGAAGTTTAAAAGTGG - Intronic
960763298 3:121097093-121097115 GCAGCCAGGAAGTTTGAACTGGG - Intronic
962128806 3:132650853-132650875 GCAGTAAACAAGTATAAAAGGGG - Intronic
962554075 3:136528230-136528252 GCAGCCAGGAAGTTCAAATTGGG - Intronic
967834207 3:193947212-193947234 GCTGCAGGGAATTTTGAAAGAGG - Intergenic
972517616 4:39822720-39822742 CCAGCCAGGAAGTTTGAAGGTGG + Intergenic
972785432 4:42322118-42322140 AAAACAAGGAATTTTAAAAGTGG + Intergenic
973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG + Intronic
973245659 4:48008848-48008870 GCAGCAAGGAAGTTTGTTTGGGG - Intronic
974280037 4:59780514-59780536 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
975772319 4:77739649-77739671 CCAGGAAAGAAGTTGAAAAGAGG + Intronic
976114869 4:81715615-81715637 GCCGCCAGGGAGTTTAAATGGGG + Intronic
976802505 4:89008281-89008303 GAGGCAAGGAAGGTTAAATGAGG + Intronic
978213416 4:106165972-106165994 GTAGAATGGAAGGTTAAAAGTGG - Intronic
982154870 4:152508677-152508699 ACAGCAAGGAAGTTAAAAATTGG + Intronic
984441832 4:179780697-179780719 GAGGTAAGTAAGTTTAAAAGAGG - Intergenic
984627432 4:182023188-182023210 GAAAAAAGAAAGTTTAAAAGAGG - Intergenic
1202752824 4_GL000008v2_random:24820-24842 GCAGCCAGGAAGTTCGAAATTGG + Intergenic
986450456 5:7858212-7858234 GCTGCAAGGAGGTGTGAAAGGGG + Intronic
986644868 5:9907121-9907143 GCAGCAAGGAAGGAGAGAAGAGG - Intergenic
987982418 5:25103380-25103402 GCAGCAAGGAAGTTTATTGGTGG - Intergenic
991084820 5:62639180-62639202 CCTGCAAGTAAGTGTAAAAGTGG + Intergenic
991341014 5:65609224-65609246 GCAGGTAGGTAGTTTAAATGTGG - Exonic
993278388 5:85892597-85892619 GAAGCAAGGAAGATGAGAAGAGG - Intergenic
994139120 5:96322491-96322513 ACAGCAAGGCATTTTCAAAGGGG - Intergenic
994843352 5:104953240-104953262 GCAGGTCAGAAGTTTAAAAGTGG - Intergenic
995855301 5:116585413-116585435 GGAGTAAGGAAGCTTAAATGAGG - Intergenic
995987352 5:118194445-118194467 GCACTAAGGAAATTTAAAAGGGG - Intergenic
999489820 5:152039057-152039079 GCAGCCAGGAAGTTTGAACTGGG - Intergenic
999881687 5:155871590-155871612 GCAACAGGGAAGGTAAAAAGAGG + Intronic
1000632378 5:163605469-163605491 TTGGCAGGGAAGTTTAAAAGGGG - Intergenic
1000954476 5:167526238-167526260 GAAGCAAGGATATTTAAAACTGG + Intronic
1003230975 6:4253571-4253593 GCTGCCAGGAAGATTAACAGTGG + Intergenic
1003811511 6:9788238-9788260 GAAGGAAGGAAGTTTTAAATTGG - Intronic
1004126458 6:12878786-12878808 GACCCAAGGAAGTTTAAAGGGGG - Intronic
1007781213 6:44256032-44256054 GCAGGAAGGAAGTATAATAACGG + Intronic
1007844465 6:44741941-44741963 GATGCAGGGAAATTTAAAAGTGG - Intergenic
1007913763 6:45541399-45541421 GCAGCCAAAACGTTTAAAAGGGG + Intronic
1008364774 6:50665057-50665079 GGAGCAACGAAGTTTAAGAGAGG + Intergenic
1008449279 6:51631564-51631586 GCAAGAGTGAAGTTTAAAAGAGG - Intronic
1009730742 6:67602374-67602396 GCAGTAATTAAGTTTAAATGAGG + Intergenic
1010316700 6:74459603-74459625 GCAGTAAGGAAATTCAAATGGGG - Intergenic
1010553522 6:77252000-77252022 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1011240362 6:85265961-85265983 GCAGAAAGGGATTTTGAAAGGGG - Intergenic
1012810746 6:103954558-103954580 GCGGCAATGAAATTTCAAAGTGG + Intergenic
1012941023 6:105415471-105415493 GCAGCAAGGAAGCTTGAACTGGG + Intergenic
1013215291 6:108021754-108021776 GCAGCAAAAAAGTATATAAGAGG - Intergenic
1013568794 6:111398886-111398908 GTAGAAAGGAAGTTAAAAACAGG - Intronic
1014974306 6:127860097-127860119 ACAGGAATGAAGTTCAAAAGAGG + Intronic
1015439025 6:133225854-133225876 CAAGCAAGCAACTTTAAAAGGGG + Intergenic
1018368627 6:163147938-163147960 GCAGCACGGAGGATTGAAAGGGG - Intronic
1023023762 7:36033475-36033497 GAAGGAAGGAAGGATAAAAGAGG + Intergenic
1023690527 7:42781499-42781521 GGAGAAAGGAAGTGTAAAATTGG + Intergenic
1024587111 7:50851486-50851508 GAAGCTAGGAAGTTTCATAGTGG + Intergenic
1024871911 7:53973389-53973411 GCAGAAAGAAATTATAAAAGAGG - Intergenic
1027765122 7:82330411-82330433 GAAAAAAGGAAGTTAAAAAGTGG - Intronic
1030240587 7:107318771-107318793 GAAGCAATTAAGTTTAAATGAGG - Intronic
1030654983 7:112157491-112157513 GCATCAAGGATTTTTAAAATAGG + Intronic
1030714575 7:112792300-112792322 GCAGAAAGTAAGTTTACTAGAGG - Intergenic
1030869834 7:114741623-114741645 GTTTCAAGGAAGTTCAAAAGAGG - Intergenic
1031154793 7:118096724-118096746 GCAGAAATGGAGATTAAAAGAGG - Intergenic
1031217589 7:118916195-118916217 ACAGGAATGAAGTTTAAAAAAGG - Intergenic
1031628458 7:124017971-124017993 GAAGCAATGAAGATTAAATGAGG + Intergenic
1032696147 7:134338226-134338248 GCAGCAGGAAACTTTGAAAGTGG - Intergenic
1033493068 7:141863339-141863361 GCAGAAAGTAAGCTGAAAAGTGG - Intergenic
1033495268 7:141887632-141887654 GCAGAAAGTAAGCTGAAAAGTGG - Intergenic
1033551785 7:142454115-142454137 GCAGCACGGAAAATTAAAAGTGG + Intergenic
1033861834 7:145637915-145637937 GCAGCAAGTAAGATTTAAGGAGG - Intergenic
1035368088 7:158361473-158361495 GCAGCAAGAAAGAGCAAAAGAGG - Intronic
1036804480 8:11820504-11820526 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1036826401 8:11979479-11979501 ACAGTTGGGAAGTTTAAAAGAGG + Intergenic
1037176000 8:15946466-15946488 GCAGCAATGAAGTCTGAAAATGG - Intergenic
1037427648 8:18773898-18773920 GAAGAAAGGAACTGTAAAAGTGG - Intronic
1038525741 8:28271627-28271649 CCAGCAAGGCTGTTGAAAAGAGG - Intergenic
1038567111 8:28628913-28628935 GCAACCAGGAAGATTAAAATGGG + Intronic
1040439025 8:47422256-47422278 GCAGCCAGGAAGCTCAAACGGGG - Intronic
1041581289 8:59462479-59462501 GCAGCCAGGAAGCTCAAAATGGG - Intergenic
1042753091 8:72179750-72179772 GCTGCATGGAAGCTTAAATGTGG + Intergenic
1043284721 8:78515179-78515201 ACAGCAAGGCAAGTTAAAAGAGG + Intergenic
1045228675 8:100278012-100278034 GCAGCAAAGAAGTTTTAGCGTGG + Intronic
1050190371 9:3018992-3019014 GAAGCAATTAAGTTTAAACGAGG - Intergenic
1050771789 9:9210532-9210554 GAAGCAAGGAAGGAGAAAAGTGG - Intronic
1050819052 9:9855232-9855254 ACAGGAAGGAAATTTAAAAAAGG + Intronic
1053146525 9:35715720-35715742 GCAGCAAAGAAGGTAAAAATAGG + Intronic
1054997368 9:71407566-71407588 GCAGCCAGGAAGCTCAAAATGGG + Intronic
1055338675 9:75259331-75259353 GCAGCCAGGAAGATTAAACTGGG - Intergenic
1055556360 9:77477585-77477607 GAAGCAAGGCACTATAAAAGAGG - Intronic
1055930825 9:81558311-81558333 GCAGCAAGGAAGTGGAACAAAGG + Intergenic
1057060587 9:92000637-92000659 GCAGCAAGGAACTGTAGAAGAGG + Intergenic
1058193940 9:101951659-101951681 ACAGCAAGGAATTATGAAAGGGG - Intergenic
1058286063 9:103179990-103180012 GCTGCAAGGAAGATTGAAAATGG + Intergenic
1058906674 9:109487540-109487562 GCTGGAAGGCTGTTTAAAAGAGG - Intronic
1059396682 9:114038606-114038628 ACAGAAAGGAAGTTTATTAGCGG - Intronic
1059431623 9:114254068-114254090 GCAGCAAGAAAGGTAGAAAGTGG + Intronic
1062104682 9:134747311-134747333 GCAGGAAGGATGCTGAAAAGAGG + Intronic
1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG + Intronic
1189533771 X:41915067-41915089 GCTGCACAGAAGTTTAAAAGAGG - Intronic
1191192794 X:57684747-57684769 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1191900096 X:66032062-66032084 ACAGCAAGGAAGTATAAATCTGG - Intronic
1191947768 X:66554169-66554191 GCTGCCAGGAAGTTTGAAATTGG + Intergenic
1192783995 X:74320467-74320489 CCAGCAAGGATGTACAAAAGGGG + Intergenic
1192804614 X:74497804-74497826 GCAGCAAGGATGTACAAAAGGGG - Intronic
1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG + Intergenic
1196160573 X:112478193-112478215 GCAGCAAGGAAGTGCATAAAGGG + Intergenic
1196545708 X:116962340-116962362 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1198935793 X:141902111-141902133 GAGGCAAGGAAGTTAAAATGTGG + Intergenic
1199196875 X:145042016-145042038 GCAGTGAGGAAGTTACAAAGAGG - Intergenic
1199469801 X:148181805-148181827 GCTGCCAGGAAGTTCAAAATGGG - Intergenic
1200732569 Y:6758398-6758420 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1201171769 Y:11273646-11273668 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1201419460 Y:13782471-13782493 GCAGCAAGGAAGTTCAAACTGGG - Intergenic
1201705120 Y:16928375-16928397 GCCGCCAGGAAGTTTGAACGGGG + Intergenic
1202026438 Y:20528670-20528692 GCAGCCAGGAAGCTCAAAATGGG + Intergenic