ID: 910820370

View in Genome Browser
Species Human (GRCh38)
Location 1:91338664-91338686
Sequence GCTAGCATGCACATGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910820365_910820370 -6 Left 910820365 1:91338647-91338669 CCTCCCCACATCACTTTGCTAGC 0: 1
1: 0
2: 3
3: 19
4: 174
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820362_910820370 23 Left 910820362 1:91338618-91338640 CCACTCTGCTGGCATGCACTCAA No data
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820359_910820370 29 Left 910820359 1:91338612-91338634 CCCCAACCACTCTGCTGGCATGC 0: 1
1: 0
2: 1
3: 15
4: 221
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820364_910820370 0 Left 910820364 1:91338641-91338663 CCATGGCCTCCCCACATCACTTT No data
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820366_910820370 -9 Left 910820366 1:91338650-91338672 CCCCACATCACTTTGCTAGCATG No data
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820367_910820370 -10 Left 910820367 1:91338651-91338673 CCCACATCACTTTGCTAGCATGC 0: 1
1: 1
2: 8
3: 41
4: 182
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820360_910820370 28 Left 910820360 1:91338613-91338635 CCCAACCACTCTGCTGGCATGCA 0: 1
1: 0
2: 2
3: 15
4: 190
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820361_910820370 27 Left 910820361 1:91338614-91338636 CCAACCACTCTGCTGGCATGCAC No data
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89
910820358_910820370 30 Left 910820358 1:91338611-91338633 CCCCCAACCACTCTGCTGGCATG 0: 1
1: 0
2: 2
3: 25
4: 213
Right 910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910820370 Original CRISPR GCTAGCATGCACATGGTGCA CGG Intronic
900765624 1:4503236-4503258 GCAAGCAAGCACAGGGTCCATGG + Intergenic
902385145 1:16072131-16072153 CCCAGCATGCACACGGTGCCTGG + Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
918656788 1:187036810-187036832 GCTAGCATTTACCTAGTGCATGG - Intergenic
920524115 1:206653555-206653577 GCGAGCATGCTCCTGGTTCATGG - Intronic
922743813 1:228031852-228031874 GCCAGCAAGCACATGGCACAGGG - Intronic
1063364850 10:5483755-5483777 GGTGGGATGCACATGGTGCTAGG + Intergenic
1064442771 10:15369738-15369760 GCTAACATGCTCAGGGTGCCTGG - Intronic
1065922328 10:30403520-30403542 GGTAGCATGCAGGTGGTTCATGG + Intergenic
1074561704 10:114540897-114540919 GCTAGCATTCACAGGTTCCAGGG - Intronic
1074591329 10:114816524-114816546 GCTACCATGCACATCCTGTAGGG - Intergenic
1076168956 10:128304384-128304406 GTTAGGATGCCCATGGTCCACGG - Intergenic
1078071428 11:8113846-8113868 GCTAGGATGAACCTGGTGCCCGG - Intronic
1079338182 11:19589618-19589640 GACAGCATGCAAATGGTGAAGGG + Intronic
1082012854 11:47462055-47462077 GCTTGAAGGCACAAGGTGCAAGG + Intergenic
1091667452 12:2429627-2429649 GGCAGTATGCACATGGTGGATGG + Intronic
1092856809 12:12681547-12681569 GCTAGCACACACATGAGGCATGG - Intronic
1096837823 12:54362318-54362340 GTGAGCATGCACATGGTGACAGG + Intergenic
1103578888 12:121899679-121899701 GCGAGCGTGCAGCTGGTGCAGGG - Exonic
1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG + Intergenic
1108354458 13:49617768-49617790 GCTATCTTGCACATGGGACAGGG - Intergenic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1110750727 13:79112256-79112278 GCTATCATGCACATGGCAAATGG + Intergenic
1122657190 14:103269940-103269962 GGTAGCCTTCACATGGTCCAAGG - Intergenic
1123423046 15:20147376-20147398 GCTGTAATGCCCATGGTGCAGGG - Intergenic
1123532271 15:21153915-21153937 GCTGTAATGCCCATGGTGCAGGG - Intergenic
1126787236 15:52187105-52187127 GCTAGCATGGTCAAGCTGCATGG + Intronic
1129199077 15:73988173-73988195 ACAAGCATGCACACGCTGCATGG + Intronic
1129227638 15:74179259-74179281 GCCAGCATTCACATGGCTCAGGG + Intergenic
1130230672 15:82094538-82094560 GCCAGCATTATCATGGTGCAGGG - Intergenic
1131307510 15:91258492-91258514 GCCACCATGGACACGGTGCAGGG - Exonic
1138581807 16:57946406-57946428 GTCAGGATGCCCATGGTGCAGGG + Intronic
1141405859 16:83792270-83792292 GCTTGCATGCGCAAGGTGCATGG - Intronic
1141751952 16:85964403-85964425 GGTAGCATTCACAGGGTCCAAGG - Intergenic
1148212953 17:45819219-45819241 GTTAACATGCACAAGGTGCTTGG - Intronic
1151331931 17:73415109-73415131 GCTGGCTTGGACATGGTGAAGGG - Intronic
1152926360 17:83089538-83089560 GCTAGCATGAACAGGGTGGGAGG - Intronic
1153158566 18:2177222-2177244 GTTACCATGCCCATGGTGAAAGG + Intergenic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1161998032 19:7726341-7726363 GGTAGCATGAACATGGCTCACGG - Intergenic
1165327453 19:35122656-35122678 CCTAGGATGCACAGGGTGCTGGG - Intronic
1165934697 19:39382191-39382213 GCTAGGATGAACATGATGGATGG - Intronic
1166648746 19:44553832-44553854 GCCAGCAGGCACAAGTTGCATGG + Intergenic
925405647 2:3604088-3604110 GCTGGCATGCACTTGGTGCCTGG + Intronic
936436982 2:112516750-112516772 GGTAGCATTGACATGGTGGATGG - Intronic
938233143 2:129679019-129679041 GCGAGCACACACATGGTTCAGGG + Intergenic
940390829 2:153130655-153130677 TCTAGTATTCACATGGAGCATGG + Intergenic
947220685 2:227788902-227788924 GCTGGCATGCACATTGTGGGTGG + Intergenic
1173270718 20:41532524-41532546 GTTAACATGCACAGGGTGTAAGG - Intronic
1174326756 20:49785345-49785367 CCTAACATGTACATGGTTCATGG - Intergenic
1178167183 21:29992536-29992558 GCTAGCAAGCGCAAGCTGCAAGG - Intergenic
1178614060 21:34114955-34114977 CTTAGCAGGCACTTGGTGCAGGG + Intronic
1179031002 21:37719263-37719285 GCATGCATGCAGATGTTGCAGGG + Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179322059 21:40301489-40301511 GCTAAGATGCAAATGGTGAATGG - Intronic
1183958511 22:41396933-41396955 GCTCTCATGCCCATGGTGGAAGG - Exonic
1184041227 22:41945262-41945284 GCTGGCATCCACATGGCGCAGGG + Exonic
950992847 3:17459344-17459366 CCTCGCATGCACAGGGTTCATGG + Intronic
951654073 3:24985113-24985135 GCTAGCATGGAAATGGTGAGGGG + Intergenic
953813413 3:46133521-46133543 GGGAGAATGCACAGGGTGCATGG - Intergenic
958959813 3:100498475-100498497 GCTAGCAGGCTGAAGGTGCAAGG - Intronic
958971087 3:100610879-100610901 GCTAGCAGGAGCATGGAGCATGG + Intronic
959659372 3:108848793-108848815 GATAGACTGCAAATGGTGCATGG - Intronic
965933384 3:174074909-174074931 ACTAGCAATCACATTGTGCACGG - Intronic
969150784 4:5166993-5167015 GCTGACATGCACATGTGGCATGG - Intronic
969936543 4:10687663-10687685 GCTAGCATGGAGAGGGAGCAAGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
983549698 4:169004049-169004071 ACTAACCTGCACATTGTGCACGG + Intronic
987404990 5:17515954-17515976 ACTGGCATGCACATTGTGCCTGG + Intergenic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
998897478 5:146815120-146815142 GCCAGCATGCACATCCTTCAGGG - Intronic
999051676 5:148530348-148530370 CCTAGGATGCACATAGTACAGGG - Intronic
999089886 5:148926830-148926852 ACTAGCATGCACCTGAGGCAGGG - Intronic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
1004159741 6:13202907-13202929 CCCCTCATGCACATGGTGCAAGG - Intronic
1004500435 6:16205218-16205240 CATAGCATGCACATGGGACATGG - Intergenic
1006579290 6:35067319-35067341 GCTATAATGGCCATGGTGCATGG - Intronic
1006913855 6:37582168-37582190 GATAGCATACACAGGCTGCAGGG - Intergenic
1017258031 6:152356642-152356664 TGTAGCATGTACATGGTGTAGGG - Intronic
1031963396 7:128009674-128009696 GCCAGAATGCACAATGTGCAGGG - Intronic
1041042067 8:53857235-53857257 GCTAGCATGCACATGTTCAGTGG + Intronic
1042019876 8:64360424-64360446 GCTATCATGGAAAAGGTGCAGGG - Intergenic
1043126476 8:76402929-76402951 GCTAGCAGCCAGATTGTGCAGGG - Intergenic
1045955473 8:107900799-107900821 TCTAGCATGTCCATGGTGCCGGG + Exonic
1046152889 8:110251840-110251862 GCTACTATGCACTTGGTGAAAGG + Intergenic
1048290379 8:133176728-133176750 GCTAGTATGCACAGTGTGCAGGG - Intergenic
1053516441 9:38734495-38734517 GCCAGCCTGGAAATGGTGCAGGG + Intergenic
1054496098 9:65824798-65824820 GCTATAATGCCCATGGTGCGGGG - Intergenic
1054818419 9:69497747-69497769 GCTAGCACAGAGATGGTGCAGGG - Intronic
1057935442 9:99234713-99234735 ACTAGTATGCTCATGGTGTATGG + Intergenic
1060061758 9:120466998-120467020 GCTAACATGCGCATGAAGCAAGG + Intronic
1060302000 9:122379583-122379605 CCAAGCAGGGACATGGTGCAAGG - Intronic
1060982558 9:127802345-127802367 GCTAGCATGAAAAAGTTGCATGG - Intronic
1187319219 X:18225681-18225703 GTTGGCATGCACATGGTGACAGG - Intergenic
1187654083 X:21449644-21449666 CCCAGGATGCACATGGAGCATGG - Intronic