ID: 910820842

View in Genome Browser
Species Human (GRCh38)
Location 1:91344230-91344252
Sequence CTGAACTATCTTATATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910820842_910820844 -10 Left 910820842 1:91344230-91344252 CCAGGAGATATAAGATAGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 143
Right 910820844 1:91344243-91344265 GATAGTTCAGAGCAGACAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910820842 Original CRISPR CTGAACTATCTTATATCTCC TGG (reversed) Intronic
900010826 1:106272-106294 CTGAACTATCTTAAGCCTCATGG - Intergenic
900026928 1:282836-282858 CTGAACTATCTTAAGCCTCATGG - Intergenic
902713608 1:18257251-18257273 CTGCACTAGCCTATGTCTCCTGG + Intronic
910421675 1:87070950-87070972 CCCAATTATCTTATATCTCCTGG + Intronic
910820842 1:91344230-91344252 CTGAACTATCTTATATCTCCTGG - Intronic
911564099 1:99441972-99441994 CTGAACCATCTTTTCTTTCCTGG - Intergenic
916512714 1:165486950-165486972 CTAAACTATCTTCTCTCTTCTGG - Intergenic
917888745 1:179415680-179415702 ATGAACTTTCTTTTCTCTCCAGG + Intronic
918822298 1:189270487-189270509 CCGAACAAAATTATATCTCCAGG + Intergenic
921163610 1:212490457-212490479 TTGAAATAGCTGATATCTCCAGG + Intergenic
921450894 1:215304155-215304177 CTGAGATATCTTATATAACCAGG - Intergenic
922045594 1:221942604-221942626 CTGAAGTATCTAATATCTTGAGG + Intergenic
922259273 1:223922279-223922301 CTGAACTATCTTAAGCCTCATGG - Intergenic
924080690 1:240394541-240394563 ATGAATTATCTTAGATCTTCTGG - Intronic
924340456 1:243025026-243025048 CTGAACTATCTTAAGCCTCATGG - Intergenic
924484310 1:244465582-244465604 GTGAACTTTCTTATTTGTCCTGG + Intronic
1062927201 10:1326319-1326341 CAGAACTATCCAATAACTCCAGG + Intronic
1063087436 10:2832403-2832425 CTTAACTATGTTATACCTGCAGG + Intergenic
1066736043 10:38480574-38480596 CTGAACTATCTTAAGCCTCATGG + Intergenic
1067458781 10:46441922-46441944 CTGAACGGTCTGTTATCTCCAGG - Intergenic
1067628412 10:47942714-47942736 CTGAACGGTCTGTTATCTCCAGG + Intergenic
1068382858 10:56280939-56280961 CTGAATTATGATATGTCTCCTGG - Intergenic
1070732477 10:78840852-78840874 CTGAAGTATCAGATGTCTCCAGG + Intergenic
1073827338 10:107339288-107339310 GTGCAAAATCTTATATCTCCAGG - Intergenic
1074788181 10:116860112-116860134 CTGAAATATCTTATCTCCACTGG + Intronic
1077718066 11:4600957-4600979 CTGAACCATTTTCTATCTCTGGG + Intronic
1080223135 11:29930060-29930082 CTGAAATTTCCTATATCTCTTGG + Intergenic
1086766854 11:90706228-90706250 CTAAAATATCTTAAATCCCCAGG - Intergenic
1087285712 11:96263013-96263035 CTGAACTTTTTTTTAACTCCCGG - Intronic
1088809076 11:113377758-113377780 CTGAGCTATCCTCTCTCTCCTGG - Intronic
1089099626 11:115951799-115951821 CTGAATTCTCTTATAGCTCATGG + Intergenic
1090672960 11:128962959-128962981 CTTAACTAGCTTAGCTCTCCAGG + Intergenic
1092601798 12:10074524-10074546 CTGAACTATATTATATCACGTGG - Intronic
1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG + Intergenic
1094121376 12:26978156-26978178 ATGAACTATCTCATAGCTCAAGG - Intronic
1097714344 12:62950307-62950329 TTGAACCATCTTGTATCTCTGGG + Intergenic
1097826915 12:64183590-64183612 CTGAACCATATTCTTTCTCCAGG + Intergenic
1098132806 12:67368144-67368166 CTGAACTATGCTACACCTCCTGG + Intergenic
1100078500 12:90819338-90819360 CTGAACTAGCTCTGATCTCCAGG - Intergenic
1103202361 12:119098224-119098246 GTGAACTATCTTATGTGTCAAGG + Intronic
1105608017 13:21943263-21943285 TTCAGCTATCTTAAATCTCCTGG - Intergenic
1107286630 13:38801270-38801292 CAGAATTATCTTGTATCTCACGG + Intronic
1109435759 13:62299232-62299254 GTGAATAATTTTATATCTCCGGG - Intergenic
1110122679 13:71902807-71902829 CTTAACCATCTTGTATCACCTGG + Intergenic
1111496684 13:89060104-89060126 CGCAACTATCTTCTATCTTCAGG - Intergenic
1111706482 13:91755714-91755736 CTGAAATATCTTACATGTCTGGG + Intronic
1115617867 14:35113460-35113482 CTGAACTTTCTTGTACTTCCGGG - Intronic
1115841106 14:37471376-37471398 CTGGACTTTGTTATATTTCCCGG + Intronic
1116121297 14:40724666-40724688 CTCAAGTATCTTAACTCTCCTGG - Intergenic
1123436531 15:20258660-20258682 CTGATCTTTCTTCTGTCTCCCGG - Intergenic
1126376220 15:47999478-47999500 CTGAATTGTCTTCTCTCTCCTGG + Intergenic
1129657818 15:77536273-77536295 CTGAAATACCTTCTCTCTCCAGG - Intergenic
1130675891 15:85951676-85951698 CTGAAATAACTTAGATCTCTAGG + Intergenic
1136848040 16:33592193-33592215 CTGATCTTTCTTCTGTCTCCAGG + Intergenic
1139067275 16:63333177-63333199 CTGAACTCTCTTGAAGCTCCTGG - Intergenic
1142453521 16:90200644-90200666 CTGAACTATCTTAAGCCTCATGG + Intergenic
1203109748 16_KI270728v1_random:1440842-1440864 CTGATCTTTCTTCTGTCTCCAGG + Intergenic
1155882017 18:31161619-31161641 CTGTACTGTCTAATATCTCTTGG - Intronic
1156848925 18:41702834-41702856 TTGTACAATCTTATCTCTCCAGG + Intergenic
1158239632 18:55361983-55362005 CTGATCTTTCTTACATCTTCTGG + Intronic
1163095356 19:15053478-15053500 CTGACATATCATATTTCTCCTGG - Exonic
1165032598 19:33009066-33009088 CTGATCTTTCTTCTGTCTCCAGG - Intronic
1165934539 19:39381159-39381181 CTGACCTTTCTTTTTTCTCCTGG + Intronic
1167068254 19:47203354-47203376 CTGAAACATCTGATATCTCTAGG + Intronic
926742040 2:16119810-16119832 CTCCACTTTCTTATATCTTCAGG - Intergenic
926933072 2:18060107-18060129 CTGACCTATCACATCTCTCCAGG + Intronic
927558883 2:24054751-24054773 CTGGACCATGTTTTATCTCCTGG + Intronic
930324320 2:49895706-49895728 CTGTGCTTTCTTATATGTCCAGG + Intergenic
930337029 2:50060996-50061018 CTGAACTATTTTATACCTAATGG - Intronic
933743858 2:85555990-85556012 CTGAATTATCTTATTTGTCAAGG - Intronic
935823158 2:106914599-106914621 ATGAACAATGTTATATCTCAGGG - Intergenic
936288349 2:111199026-111199048 CTGGGCTTTCTGATATCTCCGGG - Intergenic
936987601 2:118326493-118326515 CTGAATTATTTTCTATCACCTGG - Intergenic
938976573 2:136484040-136484062 CAAAACTATCTGATATTTCCAGG - Intergenic
939740950 2:145905016-145905038 CTGAACTAACTTATACTACCAGG + Intergenic
939979023 2:148756752-148756774 CTTAACTATCTTACTTCTTCTGG - Intronic
940954936 2:159716758-159716780 GGGAACTATCTTAAATATCCAGG - Intronic
941117513 2:161488753-161488775 CTGAATTATCTTCTACCACCTGG + Intronic
941215944 2:162709195-162709217 TTGAAATATCTTTTTTCTCCAGG - Intronic
942439040 2:176013143-176013165 CTGCACTATCTAGTACCTCCAGG + Intergenic
945460235 2:210099623-210099645 CTGAAGTATCTCACATCTTCCGG + Intronic
949084963 2:242145293-242145315 CTGAACTATCTTAAGCCTCATGG + Intergenic
1169100877 20:2947727-2947749 CTGAAATCTCTTATCTTTCCAGG - Intronic
1169561285 20:6803290-6803312 TAGAATTATTTTATATCTCCGGG - Intergenic
1172398906 20:34632139-34632161 CTGAAATATTTAATATCTTCTGG - Intronic
1178728362 21:35075881-35075903 CTAAGATATCTTTTATCTCCGGG + Intronic
1179160954 21:38898625-38898647 CGGAACTATCTTATATTACTAGG + Intergenic
952149398 3:30571163-30571185 TTGAACTATCTTGTATCCCAGGG - Intergenic
952256886 3:31703529-31703551 CAGAATCATCTTATATCTACAGG + Intronic
952645496 3:35652899-35652921 CTGAATTACCTTGTTTCTCCAGG + Intronic
955575825 3:60361845-60361867 CTGTACTATCTCATATCTCACGG + Intronic
959429274 3:106232660-106232682 TAGAACGATCTCATATCTCCCGG - Intergenic
961959044 3:130834587-130834609 CTGAACTACCTTACAGCCCCTGG - Intergenic
963604290 3:147400939-147400961 CTTAACAATGTTATATCTCCAGG - Intronic
963657599 3:148077271-148077293 CTGTAATATCTGATATCTCAGGG + Intergenic
968197382 3:196719063-196719085 CTGAACTATATGCTATCTACAGG - Intronic
971856131 4:32045827-32045849 CTGAAGTATCTTGTAGATCCTGG - Intergenic
972150763 4:36087495-36087517 CTGAGCTAACTTATATAACCTGG - Intronic
972785524 4:42323300-42323322 GGGTACTATCTTATTTCTCCTGG + Intergenic
974212113 4:58791667-58791689 ATCAACTATCTTAGATCTTCTGG - Intergenic
975853492 4:78597991-78598013 CTGAAATATTTTATTTCTACTGG + Intronic
976696959 4:87927071-87927093 CTGAACTATCTTACCCCTTCAGG + Intergenic
977138154 4:93332666-93332688 CTTAACTAATTTATATCTCCTGG - Intronic
979262396 4:118663536-118663558 CTGAACTATCTTAAGCCTCATGG + Intergenic
980041876 4:127949241-127949263 CAGTTCTATCTTAAATCTCCAGG - Intronic
980409846 4:132403164-132403186 ATGAAATATCTTGTATCTTCAGG - Intergenic
982977625 4:162086153-162086175 TTGAAGTATCTAATTTCTCCAGG + Intronic
983900111 4:173124559-173124581 CTAATCTATCTTCTGTCTCCAGG + Intergenic
987633981 5:20514909-20514931 CTGAACTCACTTATATATCATGG + Intronic
988109100 5:26792555-26792577 CTGTACTATCATATTCCTCCCGG - Intergenic
988184584 5:27844321-27844343 CTAAACTATGTGATGTCTCCTGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991531378 5:67618932-67618954 CTGAACTACCTTTCAGCTCCAGG + Intergenic
994608781 5:102008727-102008749 CCAAACTTTCTTATACCTCCTGG - Intergenic
994739052 5:103595388-103595410 ATGAGCTATCTTATATTTCTAGG + Intergenic
995557093 5:113340905-113340927 CTGAAATTGCTTTTATCTCCAGG - Intronic
999852336 5:155555629-155555651 CTGAATCATCTTATATGTTCTGG + Intergenic
1001365941 5:171139985-171140007 ATAAACTCTCTTATAACTCCAGG + Intronic
1007160312 6:39786377-39786399 CTTATTCATCTTATATCTCCAGG + Intergenic
1010273466 6:73941657-73941679 CTGAACTATCTAATCTCTACAGG - Intergenic
1013786034 6:113782146-113782168 CAGAACTATCTTGTATTTCATGG - Intergenic
1015405510 6:132833077-132833099 CTGCCCTTTCTTATCTCTCCCGG + Intergenic
1021071286 7:16244408-16244430 CTCATCTATATTATTTCTCCTGG - Intronic
1022833905 7:34095671-34095693 CTGAGCTGTCTGATAACTCCTGG - Intronic
1027533959 7:79372290-79372312 CTGAATAATCATACATCTCCTGG - Intronic
1027721256 7:81744357-81744379 CTAATCTATCTTTTATCCCCAGG - Intronic
1027838055 7:83271703-83271725 CTTAAATATTTAATATCTCCAGG + Intergenic
1031933140 7:127707269-127707291 CTGGTTTATCTAATATCTCCTGG - Intronic
1033050434 7:137999596-137999618 CTGAACTCTGTTAGATATCCAGG - Intronic
1033718355 7:144027193-144027215 CTGCACTATTTTATTTGTCCTGG - Intergenic
1035762316 8:2078049-2078071 CTGAACTAGCTCTTTTCTCCTGG + Intronic
1038133414 8:24759162-24759184 CTGCACCATCTTCAATCTCCTGG + Intergenic
1038690757 8:29760985-29761007 CTGAAACATCTTTTGTCTCCTGG + Intergenic
1041280393 8:56204387-56204409 TTGAACTATCTTAAGTTTCCAGG + Intronic
1041408893 8:57531947-57531969 CTGAATTATCTTAATTCACCTGG + Intergenic
1044263101 8:90151022-90151044 CTGAAATATCCTATTTCTCCAGG - Intergenic
1046517853 8:115286561-115286583 TTGAACTGTGTTATATCTCAAGG - Intergenic
1047670008 8:127135861-127135883 CTGGTTTCTCTTATATCTCCAGG + Intergenic
1050043864 9:1523466-1523488 CTCAAGTATCTTATAAGTCCAGG + Intergenic
1050837407 9:10100416-10100438 CTGATCTCTATTATTTCTCCAGG + Intronic
1052009573 9:23389921-23389943 CCTAACCATCTTTTATCTCCAGG - Intergenic
1052133389 9:24879636-24879658 CTGGAATTTCTCATATCTCCTGG - Intergenic
1056618929 9:88194271-88194293 CCCAAATATCATATATCTCCAGG + Intergenic
1187580895 X:20606084-20606106 CTGTACTAACTTACATTTCCAGG - Intergenic
1193342671 X:80369047-80369069 CAGAAATATTTTATATCTCTGGG - Intronic
1196563186 X:117174742-117174764 ATGAACAATCTTATAGCTACTGG + Intergenic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic
1198301510 X:135338210-135338232 CTGCACTGTCTTCTGTCTCCTGG + Intronic
1198374141 X:136020890-136020912 CTGAAGCATCTTATAGTTCCAGG - Intronic
1202384466 Y:24312022-24312044 CTGAACTATCTTAAGCCTCATGG + Intergenic
1202486317 Y:25358100-25358122 CTGAACTATCTTAAGCCTCATGG - Intergenic