ID: 910823196

View in Genome Browser
Species Human (GRCh38)
Location 1:91373869-91373891
Sequence GCTTACCACTCAATCTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910823196 Original CRISPR GCTTACCACTCAATCTTAGC AGG (reversed) Intronic
904428205 1:30445339-30445361 GCTTATCACTCAGTATTTGCAGG - Intergenic
905332719 1:37218185-37218207 GCTCCCCACTCAGTCTTTGCTGG - Intergenic
910823196 1:91373869-91373891 GCTTACCACTCAATCTTAGCAGG - Intronic
915146103 1:153796547-153796569 GCTTACCACTCAGGGTCAGCTGG - Intergenic
917721224 1:177788260-177788282 GGATGCCACTCACTCTTAGCTGG - Intergenic
919091734 1:192985660-192985682 GCTTACCACTCAATTTCAGATGG - Intergenic
1067271870 10:44798702-44798724 GCTTTCCACTCAGCCTTTGCTGG - Intergenic
1068078538 10:52289593-52289615 GCTTACAACAAATTCTTAGCAGG - Intronic
1073495818 10:103890022-103890044 GCTTCCCTCTTAATCTGAGCTGG - Intronic
1073631098 10:105150016-105150038 GTTTTCCATTCAATTTTAGCAGG + Intronic
1073677153 10:105661276-105661298 GCTTAGCACTCAGTCTTTGTTGG - Intergenic
1073861265 10:107744377-107744399 GCTCTCCACTCAGTCTTTGCTGG - Intergenic
1079794522 11:24783390-24783412 GCTCACAACTCAAGCTTACCTGG + Intronic
1081946489 11:46999581-46999603 GCTTATCACACAGCCTTAGCTGG + Intronic
1083034430 11:59623707-59623729 GCTTAACACTCAATAAAAGCTGG - Intergenic
1084322694 11:68382417-68382439 GCAGACCTCTCAATCTCAGCAGG + Intronic
1088744837 11:112796626-112796648 GCTGACCACGCATTCTAAGCAGG - Intergenic
1102141083 12:110615312-110615334 GTTTTGCACTCAATCTTAGCGGG - Intronic
1102616786 12:114161618-114161640 GTTGACCACTCAATCCTACCTGG - Intergenic
1104343359 12:127972963-127972985 TGTTACCACTCTATTTTAGCAGG + Intergenic
1107114452 13:36731821-36731843 TCTTACCACTCAATTTTAAATGG + Intergenic
1108525375 13:51281383-51281405 GCCTACCACCCACTCTTAGCTGG + Exonic
1110327279 13:74231232-74231254 GCTTATCGCTGAAACTTAGCAGG + Intergenic
1113032332 13:106008013-106008035 GAATACCACTCAATCTTAAAAGG - Intergenic
1129336006 15:74852624-74852646 CCTTTCCACTCACTGTTAGCAGG - Intronic
1141751760 16:85962864-85962886 GCTTTCCTCTCAACCTCAGCGGG + Intergenic
1143396582 17:6603889-6603911 GCTCTCCACTCAGTCTTTGCTGG - Intronic
1149648899 17:58263894-58263916 GCTTCCCACTCAATCCCTGCTGG + Intronic
1151773874 17:76184668-76184690 GATTACCATTCATTCTAAGCTGG - Intronic
1153597782 18:6746005-6746027 GCTTACATCCCAATCTTGGCTGG - Intronic
1164232647 19:23303938-23303960 TCTTACTAAGCAATCTTAGCAGG - Intergenic
928200095 2:29242323-29242345 GCTTACCTCTCAACCACAGCAGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933463422 2:82619424-82619446 GCTTCCCAGTCAATTTTGGCTGG + Intergenic
933483947 2:82895044-82895066 TCTTATCATTCAATGTTAGCTGG + Intergenic
948452369 2:238084082-238084104 GTTTCCCACTCCATCTTTGCAGG - Intronic
1170253787 20:14317209-14317231 TCTTACCACCCAATCTAAGTAGG + Intronic
1177815391 21:25970965-25970987 TCTTCTCACTCAATCTTGGCTGG - Intronic
1184243631 22:43224526-43224548 GCTTCCAACTCAATCCAAGCTGG + Intronic
950372424 3:12542406-12542428 ACTTACCACTCATCTTTAGCAGG - Intronic
953604234 3:44399552-44399574 TCTTTCCACTCAATCGCAGCAGG + Intronic
954179265 3:48868756-48868778 GCTTCCCACTAAGTCTTTGCTGG - Intronic
955666518 3:61355131-61355153 GCTTCCCACTCAAGCTTTGCTGG + Intergenic
959960737 3:112295081-112295103 GCTTCCTACTCAGTCTTTGCTGG + Intergenic
959977612 3:112479706-112479728 TCTGAACACTCCATCTTAGCAGG - Exonic
962113513 3:132475819-132475841 GCTGACCACTAAATGTTGGCTGG + Intronic
966038294 3:175447702-175447724 GCTATCCACTGAATCTTGGCAGG - Intronic
969880532 4:10169879-10169901 GTTTACCTCCCAATCTTGGCTGG - Intergenic
987759661 5:22144647-22144669 TCTTACCAGTTAATCTAAGCAGG - Intronic
990280441 5:54245228-54245250 AGTAACCACTGAATCTTAGCAGG + Intronic
991894386 5:71378075-71378097 TCTTACCAGTTAATCTAAGCAGG - Intergenic
998434377 5:142095098-142095120 GCTTCAAACTCAATTTTAGCTGG + Intergenic
1011754275 6:90483180-90483202 GCAAATCACTCAATCTCAGCTGG - Intergenic
1012118210 6:95331479-95331501 CCTTCCCATTGAATCTTAGCTGG - Intergenic
1024652257 7:51414495-51414517 GCATACAAGTCAATCTCAGCCGG - Intergenic
1042168116 8:65966149-65966171 GGTCACCACCCATTCTTAGCGGG + Intergenic
1042213293 8:66403143-66403165 GCTTACAACTCTTTCTTGGCAGG + Intergenic
1045260486 8:100569095-100569117 GGTTTCCTCTCAATCTTATCAGG + Intergenic
1048713195 8:137234699-137234721 GCTTACCAATCTCTCTCAGCAGG - Intergenic
1048904254 8:139072445-139072467 GCTTACAACTGACTCTCAGCAGG + Intergenic
1048919862 8:139218404-139218426 GCTTGCCACTCCATCATGGCTGG - Intergenic
1048952072 8:139504648-139504670 CCTTCCCACTCATTCTTAGAGGG - Intergenic
1057747518 9:97763814-97763836 GCTAACCAAGCAATTTTAGCAGG + Intergenic
1057945588 9:99325382-99325404 GCTCACCACTCCATCTTAAGAGG + Intergenic
1187640192 X:21279257-21279279 GATTACCACACAATAATAGCTGG + Intergenic
1189229696 X:39442662-39442684 GCTGACCCCTCAATCATAGGAGG + Intergenic
1190781331 X:53598866-53598888 GCTTATTACTAAATTTTAGCAGG - Intronic
1194585424 X:95727631-95727653 CCTTACCACTGACTCTTAGAGGG - Intergenic
1196634662 X:117988582-117988604 GATTACCACTCAATCTAATGGGG + Intronic
1199164739 X:144658134-144658156 GCTAACCACTCAGGTTTAGCAGG + Intergenic
1199692887 X:150322065-150322087 GCTTTCCACTCAGTCTTTGCTGG - Intergenic
1200364043 X:155642199-155642221 CCTTATCACTCAATCTTAGTAGG + Intronic