ID: 910825709

View in Genome Browser
Species Human (GRCh38)
Location 1:91404845-91404867
Sequence CCTCTGAGGACCGCCAAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910825704_910825709 -9 Left 910825704 1:91404831-91404853 CCGATTTATCAGCCCCTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825697_910825709 30 Left 910825697 1:91404792-91404814 CCTCACCTCCCTGCGGACAGCTC 0: 1
1: 0
2: 1
3: 35
4: 269
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825701_910825709 21 Left 910825701 1:91404801-91404823 CCTGCGGACAGCTCCTAGGCCAG 0: 1
1: 0
2: 1
3: 8
4: 114
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825698_910825709 25 Left 910825698 1:91404797-91404819 CCTCCCTGCGGACAGCTCCTAGG 0: 1
1: 0
2: 1
3: 12
4: 111
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825700_910825709 22 Left 910825700 1:91404800-91404822 CCCTGCGGACAGCTCCTAGGCCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825702_910825709 8 Left 910825702 1:91404814-91404836 CCTAGGCCAGTCGAGCGCCGATT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148
910825703_910825709 2 Left 910825703 1:91404820-91404842 CCAGTCGAGCGCCGATTTATCAG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910825709 Original CRISPR CCTCTGAGGACCGCCAAGCC TGG Exonic