ID: 910826284

View in Genome Browser
Species Human (GRCh38)
Location 1:91410964-91410986
Sequence CCTGGCAACATGTTGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910826284_910826293 25 Left 910826284 1:91410964-91410986 CCTCAGAACAACATGTTGCCAGG No data
Right 910826293 1:91411012-91411034 AACTGTCACCATGGCTGCAGGGG No data
910826284_910826290 16 Left 910826284 1:91410964-91410986 CCTCAGAACAACATGTTGCCAGG No data
Right 910826290 1:91411003-91411025 AGGCAGCAGAACTGTCACCATGG No data
910826284_910826289 -4 Left 910826284 1:91410964-91410986 CCTCAGAACAACATGTTGCCAGG No data
Right 910826289 1:91410983-91411005 CAGGGTAGAGGCGCTGAAGCAGG No data
910826284_910826292 24 Left 910826284 1:91410964-91410986 CCTCAGAACAACATGTTGCCAGG No data
Right 910826292 1:91411011-91411033 GAACTGTCACCATGGCTGCAGGG No data
910826284_910826291 23 Left 910826284 1:91410964-91410986 CCTCAGAACAACATGTTGCCAGG No data
Right 910826291 1:91411010-91411032 AGAACTGTCACCATGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910826284 Original CRISPR CCTGGCAACATGTTGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr