ID: 910831095

View in Genome Browser
Species Human (GRCh38)
Location 1:91463388-91463410
Sequence GATAGCTCTTGGCCTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910831095_910831098 11 Left 910831095 1:91463388-91463410 CCAATAACAGGCCAAGAGCTATC No data
Right 910831098 1:91463422-91463444 GAATAGTTGTCTGCAAAAGATGG No data
910831095_910831100 16 Left 910831095 1:91463388-91463410 CCAATAACAGGCCAAGAGCTATC No data
Right 910831100 1:91463427-91463449 GTTGTCTGCAAAAGATGGCAGGG No data
910831095_910831099 15 Left 910831095 1:91463388-91463410 CCAATAACAGGCCAAGAGCTATC No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910831095 Original CRISPR GATAGCTCTTGGCCTGTTAT TGG (reversed) Intergenic
No off target data available for this crispr