ID: 910831099

View in Genome Browser
Species Human (GRCh38)
Location 1:91463426-91463448
Sequence AGTTGTCTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910831097_910831099 4 Left 910831097 1:91463399-91463421 CCAAGAGCTATCTCTCAAAAGGA No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data
910831093_910831099 22 Left 910831093 1:91463381-91463403 CCAAAGCCCAATAACAGGCCAAG No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data
910831094_910831099 16 Left 910831094 1:91463387-91463409 CCCAATAACAGGCCAAGAGCTAT No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data
910831092_910831099 25 Left 910831092 1:91463378-91463400 CCACCAAAGCCCAATAACAGGCC No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data
910831095_910831099 15 Left 910831095 1:91463388-91463410 CCAATAACAGGCCAAGAGCTATC No data
Right 910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910831099 Original CRISPR AGTTGTCTGCAAAAGATGGC AGG Intergenic
No off target data available for this crispr