ID: 910832865

View in Genome Browser
Species Human (GRCh38)
Location 1:91478097-91478119
Sequence TTGTATGTTTAGTAAAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910832865_910832873 24 Left 910832865 1:91478097-91478119 CCCCGCCTTTACTAAACATACAA No data
Right 910832873 1:91478144-91478166 CCCCTGTAGTCCCAGCTACTTGG 0: 930
1: 73039
2: 137837
3: 166138
4: 116139
910832865_910832870 -3 Left 910832865 1:91478097-91478119 CCCCGCCTTTACTAAACATACAA No data
Right 910832870 1:91478117-91478139 CAAAATTTAGCCAGGCATGACGG 0: 20
1: 1938
2: 26332
3: 74205
4: 149276
910832865_910832875 25 Left 910832865 1:91478097-91478119 CCCCGCCTTTACTAAACATACAA No data
Right 910832875 1:91478145-91478167 CCCTGTAGTCCCAGCTACTTGGG 0: 578
1: 47211
2: 210657
3: 282394
4: 198450
910832865_910832877 28 Left 910832865 1:91478097-91478119 CCCCGCCTTTACTAAACATACAA No data
Right 910832877 1:91478148-91478170 TGTAGTCCCAGCTACTTGGGAGG 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910832865 Original CRISPR TTGTATGTTTAGTAAAGGCG GGG (reversed) Intergenic
No off target data available for this crispr