ID: 910840122

View in Genome Browser
Species Human (GRCh38)
Location 1:91553441-91553463
Sequence CCAAGCTGGCCCACAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910840122_910840134 28 Left 910840122 1:91553441-91553463 CCTGCATTTGTGGGCCAGCTTGG No data
Right 910840134 1:91553492-91553514 AGTGAACAATCCTGTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910840122 Original CRISPR CCAAGCTGGCCCACAAATGC AGG (reversed) Intergenic
No off target data available for this crispr