ID: 910843681

View in Genome Browser
Species Human (GRCh38)
Location 1:91585578-91585600
Sequence CCAGTCGGTCCCCTGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910843669_910843681 7 Left 910843669 1:91585548-91585570 CCTTCACCACCCCATGTTCCCCC No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843668_910843681 18 Left 910843668 1:91585537-91585559 CCTCTCTTTTGCCTTCACCACCC No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843673_910843681 -4 Left 910843673 1:91585559-91585581 CCATGTTCCCCCATGCTGACCAG No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843670_910843681 1 Left 910843670 1:91585554-91585576 CCACCCCATGTTCCCCCATGCTG No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843672_910843681 -3 Left 910843672 1:91585558-91585580 CCCATGTTCCCCCATGCTGACCA No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843667_910843681 19 Left 910843667 1:91585536-91585558 CCCTCTCTTTTGCCTTCACCACC No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data
910843671_910843681 -2 Left 910843671 1:91585557-91585579 CCCCATGTTCCCCCATGCTGACC No data
Right 910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910843681 Original CRISPR CCAGTCGGTCCCCTGAAGGC AGG Intergenic
No off target data available for this crispr