ID: 910850032

View in Genome Browser
Species Human (GRCh38)
Location 1:91641202-91641224
Sequence CATCTGCTGGGACCCTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910850027_910850032 3 Left 910850027 1:91641176-91641198 CCCTCCAGTTACTCTTCTACAAA No data
Right 910850032 1:91641202-91641224 CATCTGCTGGGACCCTGATATGG No data
910850028_910850032 2 Left 910850028 1:91641177-91641199 CCTCCAGTTACTCTTCTACAAAT No data
Right 910850032 1:91641202-91641224 CATCTGCTGGGACCCTGATATGG No data
910850029_910850032 -1 Left 910850029 1:91641180-91641202 CCAGTTACTCTTCTACAAATCAC No data
Right 910850032 1:91641202-91641224 CATCTGCTGGGACCCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910850032 Original CRISPR CATCTGCTGGGACCCTGATA TGG Intergenic
No off target data available for this crispr