ID: 910852901

View in Genome Browser
Species Human (GRCh38)
Location 1:91666099-91666121
Sequence CAGTGTTGGGAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910852894_910852901 24 Left 910852894 1:91666052-91666074 CCAAGGAACGCTGTCTCCTCCTT No data
Right 910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG No data
910852896_910852901 5 Left 910852896 1:91666071-91666093 CCTTGTCGTGAGAGACACGAAGT 0: 19
1: 48
2: 96
3: 63
4: 70
Right 910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG No data
910852895_910852901 8 Left 910852895 1:91666068-91666090 CCTCCTTGTCGTGAGAGACACGA 0: 3
1: 18
2: 53
3: 77
4: 73
Right 910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910852901 Original CRISPR CAGTGTTGGGAGAAGGAGGC TGG Intergenic
No off target data available for this crispr