ID: 910856037

View in Genome Browser
Species Human (GRCh38)
Location 1:91696878-91696900
Sequence TGGGCAGCCCAGCACTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910856032_910856037 -3 Left 910856032 1:91696858-91696880 CCATACACTCCTGTGACCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 910856037 1:91696878-91696900 TGGGCAGCCCAGCACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910856037 Original CRISPR TGGGCAGCCCAGCACTCCAA AGG Intronic
No off target data available for this crispr