ID: 910864852

View in Genome Browser
Species Human (GRCh38)
Location 1:91779049-91779071
Sequence GTGAGCAATGGTGAGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910864844_910864852 24 Left 910864844 1:91779002-91779024 CCCATGCCAAGGACAGGAGGCAA 0: 1
1: 0
2: 0
3: 15
4: 209
Right 910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 254
910864845_910864852 23 Left 910864845 1:91779003-91779025 CCATGCCAAGGACAGGAGGCAAG 0: 1
1: 0
2: 1
3: 22
4: 281
Right 910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 254
910864849_910864852 -9 Left 910864849 1:91779035-91779057 CCCACTGCAGCACAGTGAGCAAT 0: 1
1: 0
2: 0
3: 14
4: 173
Right 910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 254
910864850_910864852 -10 Left 910864850 1:91779036-91779058 CCACTGCAGCACAGTGAGCAATG No data
Right 910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 254
910864846_910864852 18 Left 910864846 1:91779008-91779030 CCAAGGACAGGAGGCAAGATGTC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910864852 Original CRISPR GTGAGCAATGGTGAGAGTGC TGG Intronic
900074760 1:804545-804567 GTGACCAAAGATGAGAGAGCAGG + Intergenic
902232925 1:15039494-15039516 GTGAACCATGGGTAGAGTGCTGG + Intronic
902255564 1:15186789-15186811 GAGAGCAGTGGAGAGAGGGCAGG + Intronic
902571922 1:17352505-17352527 GTGAGGGATGCTGGGAGTGCAGG + Intronic
903584546 1:24401543-24401565 CTGAGAAATGGTGTGGGTGCCGG + Intronic
906109511 1:43313416-43313438 CTGGGCAACGGTGAGAGGGCAGG + Exonic
909061375 1:70882546-70882568 TGGAGCTATGGTGACAGTGCTGG + Intronic
909831302 1:80194035-80194057 GTGAGCCATGGTGGGATTCCTGG + Intergenic
909935030 1:81541469-81541491 GTGTGAAAAGGTGAGAGTTCAGG - Intronic
910864426 1:91775332-91775354 GTTAGCAAGGGGGAGAGTGGTGG - Intronic
910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG + Intronic
912560283 1:110546627-110546649 GTGAGCAAGGGGGAGAGTGCTGG - Intergenic
912560550 1:110548397-110548419 GTGGGCAATGGTGGGTGTGGTGG + Intergenic
912601770 1:110942589-110942611 GTGAGCAATGGTCGGATTCCAGG + Intergenic
915642120 1:157236056-157236078 TTCAGCTATGGTGAGAGTGTAGG + Intergenic
920284415 1:204869145-204869167 GGGAGCCAGGGTGGGAGTGCGGG + Intronic
922270604 1:224029450-224029472 GTGACCAAAGATGAGAGAGCAGG + Intergenic
922504228 1:226117285-226117307 GGGAGCTAAGGGGAGAGTGCTGG + Intergenic
922931215 1:229391072-229391094 GGGAGCCATGGTGAGGGTGCGGG - Intergenic
924769195 1:247064093-247064115 TTGGGAAATGGTGAGTGTGCAGG - Intronic
924770888 1:247078581-247078603 CTGGGAAATGGTGAGTGTGCCGG - Exonic
1062893310 10:1082965-1082987 GTTAGAAATGGTGAGAGGCCTGG + Intronic
1062910647 10:1209574-1209596 GTGGGTGATGGTGAGAGTGTGGG - Intronic
1063585497 10:7348973-7348995 ATGAGAAATGGAGAGAGTCCTGG + Intronic
1063701236 10:8387261-8387283 GGGTGCAGTGGTGAGAGAGCTGG + Intergenic
1067190278 10:44062753-44062775 GTGAGTGCTGGTGAGGGTGCAGG + Intergenic
1067437277 10:46287122-46287144 GTGTGCACTGGTGAAAGGGCAGG + Exonic
1067555194 10:47264742-47264764 ATGAGCACTGGAGAGAGGGCTGG - Intergenic
1068634745 10:59336434-59336456 GTGAGCAGTGGTCATAGTGGTGG - Intronic
1069277561 10:66611586-66611608 GTGAGAAATGAGGAGAGGGCAGG - Intronic
1070394498 10:76000469-76000491 CTGAACAATGGTGAGAGGGAAGG + Intronic
1071461791 10:85903710-85903732 GTGAGTGATGGAGAGAGTGGTGG - Intronic
1071489179 10:86124319-86124341 GTGAGCCAGGGGGAGAGTGGTGG - Intronic
1071974134 10:90938183-90938205 GTTGGCGATGGTGAGAGTGAGGG - Intergenic
1073231169 10:101971497-101971519 GAGAGCAGTGGTGTGATTGCGGG - Intronic
1074136558 10:110632386-110632408 GTGAGGAACAGTGAGTGTGCTGG + Intergenic
1074279465 10:112037288-112037310 TTGAGCAATGGTAAGAGTGGAGG - Intergenic
1075199740 10:120392628-120392650 GAGAACAATGCTGAGCGTGCTGG - Intergenic
1075260895 10:120963181-120963203 GCGAGCCATGGAGACAGTGCAGG - Intergenic
1076030133 10:127150314-127150336 GTGAGCAATGGGGATTGAGCTGG - Intronic
1076098271 10:127752056-127752078 AAAAGCAATGGTGAAAGTGCTGG + Intergenic
1076165128 10:128275701-128275723 GTGAGCAGTGGTGTGTGTCCTGG + Intergenic
1076250436 10:128980163-128980185 GCGAGCCATGCTCAGAGTGCAGG - Intergenic
1077109014 11:853961-853983 GTTAGCAATGGTGAGGGCGTGGG + Intronic
1079930318 11:26550910-26550932 GTAAGTATTGGTGAGAATGCGGG - Intronic
1080579544 11:33631087-33631109 GTGAGTAATGGAGACAGTACTGG - Intronic
1081020630 11:37943826-37943848 GTGAGGAATGGATAAAGTGCTGG - Intergenic
1082184696 11:49164926-49164948 GTGGGCCATGGTGAGAATGATGG - Intronic
1083285536 11:61656464-61656486 GTGCGGGGTGGTGAGAGTGCAGG + Intergenic
1083285566 11:61656563-61656585 GTGAGGGATGGTGAGAATGCAGG + Intergenic
1084154332 11:67305092-67305114 GGGAGCAATGGTGTGAGGGCAGG + Intronic
1085164211 11:74381881-74381903 GGAAGCAATGGTTAGCGTGCTGG - Intronic
1085571070 11:77558524-77558546 GTGAGTAATGGGGAAACTGCTGG - Intronic
1086166979 11:83790635-83790657 GGTAGCAATGGTGAGAGTGGAGG + Intronic
1086278156 11:85156680-85156702 ATTAGCAATGGTGACAGTGCAGG - Intronic
1087379613 11:97387586-97387608 CTGAGAAATGGTGAGAATGGTGG - Intergenic
1095711445 12:45292972-45292994 GTGAGCAGTGGGCAGAGTGCCGG + Intronic
1096117929 12:49066592-49066614 GTGACCAAGGTTGTGAGTGCGGG - Intronic
1096525913 12:52210298-52210320 GGGAGCAGTGGTGAGAAGGCAGG + Intergenic
1096743386 12:53710477-53710499 GAGAGCCTTGGTGAGCGTGCAGG + Intronic
1097289738 12:57904707-57904729 TTGAGCCACGGTGAGAATGCTGG + Intergenic
1097624556 12:61983924-61983946 GTGATCTATGGTGATAGTTCAGG - Intronic
1097745720 12:63300880-63300902 ATGAGCAATGAGGAGAGTGATGG - Intergenic
1098249153 12:68550829-68550851 GTGAGGAAGGGGGAGAGTGAGGG - Intergenic
1098358341 12:69631694-69631716 GTGAGCATTGGTCTGAATGCTGG - Intergenic
1098823782 12:75268024-75268046 GTAAGCCAGGGTGAGAGTCCTGG - Intergenic
1102236652 12:111298177-111298199 GTGACCACTGGGGACAGTGCAGG + Intronic
1103940015 12:124496400-124496422 GTGTGCAATTGTGGGGGTGCTGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1110258588 13:73459467-73459489 GTGAGCTGTGCTGAGAGTGGAGG + Intergenic
1112069398 13:95831723-95831745 ATGAGCATTGGTGAGAATGTTGG - Intronic
1113510518 13:110850822-110850844 GACAGCAAGGGTGAGGGTGCGGG + Intergenic
1113547187 13:111162513-111162535 GTCTGCAAAGGTGAGAGGGCAGG + Intronic
1114356775 14:21918468-21918490 GTGAGCAGAGGAGAGAGTGTGGG + Intergenic
1114577566 14:23728067-23728089 GTGAGTGCTGGTGTGAGTGCAGG + Intergenic
1115768736 14:36648350-36648372 GTGACCCAGGGAGAGAGTGCGGG - Intergenic
1118934511 14:70274643-70274665 GTCAGCTATGGTGAGAGGGATGG + Intergenic
1119209041 14:72816171-72816193 GTGTACAAGGGTGGGAGTGCAGG - Intronic
1119546810 14:75477889-75477911 GAGAGCAGTGGCGAGGGTGCAGG + Intergenic
1119952781 14:78763019-78763041 GTTGGCAATGGCGGGAGTGCTGG + Intronic
1120003472 14:79330218-79330240 GGGAGCTATTGTGAGAGTCCAGG + Intronic
1121671175 14:95711845-95711867 GTGAGGAATGGAGGGAGTGGAGG - Intronic
1122038503 14:98965276-98965298 GTGAGCCTGGGAGAGAGTGCTGG - Intergenic
1123007062 14:105329041-105329063 GGGAGCAGTGGGGAGTGTGCTGG + Intronic
1124013651 15:25859350-25859372 GTGAGCCCTGGTGAGAGTCGAGG - Intronic
1125582764 15:40798577-40798599 GTCAGCAAAGGGGAGAGTGGTGG + Intronic
1125935668 15:43633431-43633453 GTGAGCAGGGGGAAGAGTGCTGG - Intronic
1125948439 15:43729895-43729917 GTGAGCAGGGGGAAGAGTGCTGG - Intergenic
1128153900 15:65379907-65379929 GTGAGAAAGGGTGGGAGTGGTGG + Intergenic
1128184784 15:65635509-65635531 GTGAGAAATAGTGAGATGGCTGG + Intronic
1129884024 15:79026235-79026257 GGGGACAATGGTAAGAGTGCAGG - Intronic
1130333245 15:82937709-82937731 GTGACCAATGGAGACAGAGCAGG + Intronic
1134763433 16:16734412-16734434 GTAAGCAATGGCGAGAGGGACGG - Intergenic
1134982619 16:18624745-18624767 GTAAGCAATGGCGAGAGGGACGG + Intergenic
1135980365 16:27142366-27142388 TTGTGGAGTGGTGAGAGTGCAGG + Intergenic
1136672877 16:31873960-31873982 CTGGGAAATGGTGAGTGTGCGGG + Exonic
1137370752 16:47903707-47903729 GTGAGCAAGGGTGAGAGTTGGGG + Intergenic
1137501513 16:49015003-49015025 GTGGGCAATGGAGAGGGTGGCGG + Intergenic
1138831044 16:60374781-60374803 TTGAGAAAGGGTGAGTGTGCTGG + Intergenic
1139489542 16:67279136-67279158 GTGAGCGAGGGTGAGTGCGCGGG - Exonic
1140327454 16:74018676-74018698 GGGAGCAAAAGTGATAGTGCTGG - Intergenic
1140863306 16:79038089-79038111 ATGAGCAGTTGGGAGAGTGCAGG + Intronic
1141564830 16:84894174-84894196 GTGGGCAGGGGTGAGAGAGCAGG - Intronic
1141802369 16:86319532-86319554 GAGAGCTATGATGAGAGTGGAGG - Intergenic
1147419383 17:40314569-40314591 GTGGGCAGTGGTGAGGGGGCAGG + Intronic
1147430629 17:40368404-40368426 GTCAGCAATGGTGATCTTGCTGG - Intergenic
1148778132 17:50107144-50107166 GAGATCAATGGTGAGTGAGCGGG + Exonic
1149464287 17:56862673-56862695 GTGAGTTATGGTGACAGTGCAGG - Exonic
1151828192 17:76535271-76535293 GAGGGCAGAGGTGAGAGTGCTGG + Intronic
1153838735 18:8987469-8987491 GTGAGCAATGGTGTGATGCCTGG - Intergenic
1153988000 18:10369721-10369743 GTGAGCACTGGGGAGACTGCTGG + Intergenic
1155201248 18:23519761-23519783 GTGAGCATGGATGACAGTGCTGG + Intronic
1159590196 18:70325590-70325612 GGTAGCAATGGTGAGAGTGGAGG - Exonic
1159908398 18:74119515-74119537 GTGAGAAATGGGGAGAGTGAGGG + Intronic
1160443997 18:78913365-78913387 GTGAGCAGGGGTGGGAGTGGGGG - Intergenic
1161944199 19:7424625-7424647 GTAAGTGATGGTAAGAGTGCTGG + Intronic
1162609596 19:11738804-11738826 CTGGGAAATGGTGAGTGTGCGGG - Exonic
1162644010 19:12035524-12035546 GCAAGAAATGGTGAGCGTGCGGG - Exonic
1162711357 19:12597136-12597158 CCGAGAAATGGTGAGTGTGCGGG - Intronic
1163859338 19:19732943-19732965 CTGGGAAATGGTGAGTGTGCGGG - Exonic
1163878957 19:19901082-19901104 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1163948847 19:20565625-20565647 CCTAGAAATGGTGAGAGTGCCGG - Exonic
1163969240 19:20776441-20776463 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1163993391 19:21020794-21020816 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1163999268 19:21082339-21082361 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1164005200 19:21142177-21142199 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1164018003 19:21269761-21269783 CCTAGAAATGGTGAGAGTGCTGG - Intronic
1164026649 19:21359134-21359156 CCTAGAAATGGTGAGAGTGCGGG + Exonic
1164049149 19:21569091-21569113 CCTAGAAATGGTGAGAGTGCCGG - Intergenic
1164077795 19:21836023-21836045 CCTAGAAATGGTGAGAGTGCCGG - Exonic
1164079733 19:21851892-21851914 CTGGGAAATGGTGAGTGTGCGGG - Intronic
1164100766 19:22052626-22052648 CCTAGAAATGGTGAGAGTGCTGG + Exonic
1164123184 19:22286546-22286568 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1164176998 19:22784001-22784023 CTTAGAAATGGTGAGAGTGCCGG - Exonic
1164213070 19:23117167-23117189 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1164296493 19:23914988-23915010 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1165343052 19:35225939-35225961 GTGAGTAAAGGGGAGAGTGAAGG - Intronic
1166515131 19:43440806-43440828 GTGAGCAATGGAAAGAAGGCTGG + Intergenic
1168236914 19:55069267-55069289 GCCAGCCCTGGTGAGAGTGCGGG - Intronic
1168272109 19:55255639-55255661 GAGAGCTTTGGTGAGAGTGAGGG - Intronic
1168311477 19:55463198-55463220 GTGAGCCTGGGTGAGAGTGAGGG + Intergenic
1168705957 19:58470406-58470428 GTAAGCAATGGAAAGAGTGTGGG + Intronic
926078605 2:9964504-9964526 GGGAGCAATGGTGAGAGCACTGG - Intronic
927099939 2:19780418-19780440 GTGAGCAAAGGTGTGCGGGCTGG - Intergenic
929096116 2:38264645-38264667 GTGAGCAAGGGGAAGAGTGTTGG + Intergenic
929157955 2:38804655-38804677 ATGATCAAGGGTGAGAGTGGTGG - Intronic
931646373 2:64425281-64425303 GGGAGCAATAGGGAGAGTGGAGG - Intergenic
932269655 2:70398461-70398483 CTGAGCAATGGACAGAGTGTTGG + Intergenic
934704091 2:96464248-96464270 CTGAGCTAGGGTGAGAGGGCTGG - Intergenic
936404181 2:112187604-112187626 GGGTGCACTGGTGAGAGGGCGGG - Exonic
936524237 2:113232136-113232158 CTGAGCCATGGTGAGAGAGCTGG - Intronic
939136830 2:138306333-138306355 GTGAGGAATGGTGTGTGTGTCGG - Intergenic
939323900 2:140661707-140661729 GTGAGCAATGTAGACAGTTCTGG + Intronic
939676960 2:145084552-145084574 GTGAGAAATGATGAGAGAGAGGG - Intergenic
942365992 2:175228364-175228386 GGCAGCAATGATGACAGTGCAGG + Intergenic
944594228 2:201246646-201246668 GTGTGGAATGGTGAGAATACAGG - Intronic
946872467 2:224096832-224096854 GTGAGCCAGAGAGAGAGTGCAGG + Intergenic
948297853 2:236876144-236876166 GTCAGCCATGGGGAGAGTGATGG + Intergenic
1168964015 20:1888016-1888038 GTGAGCAAGGGGGAGAGTGTGGG + Intergenic
1169504973 20:6200127-6200149 GTGAGAGAAGGAGAGAGTGCAGG - Intergenic
1169880455 20:10341475-10341497 GTGAGCACAGGAGAGAGTGAGGG + Intergenic
1171311979 20:24151942-24151964 ATGTGTAATGGTGAGAGTGAGGG - Intergenic
1171795058 20:29560140-29560162 GTGGGCAATGATAAGAGGGCAGG - Intergenic
1172040536 20:32041547-32041569 GTGAGTGATAGTGACAGTGCTGG - Intergenic
1173207246 20:41004756-41004778 GTCAGCAATGGTTTGAATGCAGG - Intergenic
1173244880 20:41329859-41329881 AGGAGCAATGGTCAGAGTGGAGG - Intergenic
1175257956 20:57658208-57658230 GTGAGCATTGGTGGGTGTTCTGG - Intronic
1175881710 20:62263072-62263094 GTGAGCAGTGGTGGGGGTGAGGG + Intronic
1176111578 20:63413360-63413382 GTGGCCCATGGTGGGAGTGCAGG - Intronic
1177311762 21:19405532-19405554 GTGTGTAGTGGTGAGAGTGGAGG + Intergenic
1177872600 21:26591488-26591510 GGGAGCAATAGAGAGAGTGGAGG - Intergenic
1178890814 21:36519851-36519873 GTGAGCAATGATCTGAATGCTGG - Intronic
1181898700 22:26133960-26133982 GTGAGCAAGCGTGAGGGTGTGGG - Intergenic
1182568871 22:31221114-31221136 GTAAGGAATGGTGAGAGAGAAGG + Intronic
1183095696 22:35550908-35550930 GTCAGTAATGATGAGAGTGAGGG - Intronic
1184077887 22:42194939-42194961 GTGAGCACTTGTGTAAGTGCTGG - Intronic
1185116995 22:48943625-48943647 GTGAGTAATGGTGTGATTTCAGG - Intergenic
950095359 3:10326277-10326299 GTGTGCAAGTGTGAGAGTGAGGG + Exonic
950525318 3:13519601-13519623 CTGAGCATTGGAGAGACTGCTGG + Intergenic
951806661 3:26652084-26652106 TTGGGCAATGGTGGGAGTGCAGG + Intronic
952881410 3:37988239-37988261 GTAAGCCATGGGGAGAGTGATGG + Intronic
952970227 3:38646039-38646061 TCGAGCCATGGTGAGGGTGCTGG - Intronic
954211872 3:49102359-49102381 GTGAGGTATGGTGAGACTTCAGG - Intronic
955396829 3:58563539-58563561 GTGAGCAAGTGGGAGAGTGCAGG + Intergenic
955888181 3:63622184-63622206 ATGAGGAGTGGTGCGAGTGCTGG + Intergenic
961429774 3:126873192-126873214 ATGAGAAATAGTGATAGTGCTGG + Intronic
962561885 3:136615204-136615226 ATGAGCAATGGTGTGAATGTGGG + Intronic
962852801 3:139320217-139320239 GGGAACAAGGGTGAGAGTGTGGG - Intronic
962898048 3:139733731-139733753 GTGAGCAGTGGTGAAATGGCTGG + Intergenic
964449676 3:156800092-156800114 GTAAGCAAGGGTGAGTGTGGAGG + Intergenic
964464927 3:156981334-156981356 CTGAGAAATGGTGAGAGTCAGGG + Intronic
965406801 3:168279441-168279463 GTGAAGCAAGGTGAGAGTGCTGG + Intergenic
966938802 3:184732085-184732107 GTGAGCTTGGGTGAGAGTGGGGG + Intergenic
968419765 4:473968-473990 CTGAGAAATGGTGAGTGTGCGGG - Intronic
969167060 4:5324800-5324822 GTGTGGAATTGTGAGAGTGTGGG + Intronic
969417871 4:7072918-7072940 GTGAGGATTGGTGAGAGGGAAGG + Intergenic
970020795 4:11566119-11566141 TTTAGCATTGGTGAGAGTGTAGG - Intergenic
970413982 4:15838461-15838483 GTGAGCAATGGGTAGGGTGGAGG - Intronic
971371676 4:26024362-26024384 GTGAGCAAAGGTGAGATCGTAGG + Intergenic
971550640 4:27951701-27951723 GAGAGCAATAGAGAGAGAGCAGG + Intergenic
974692426 4:65314614-65314636 GTTAGTAATTGTGAGAATGCAGG - Intergenic
974766172 4:66348996-66349018 GGCAGCAATGGTGAGAGGGTTGG - Intergenic
975457483 4:74609269-74609291 GTGAGCAAAGGTATGACTGCAGG - Intergenic
975590495 4:75994965-75994987 GTAAGCAAAGGGGAGAGTGATGG - Intergenic
975673731 4:76806514-76806536 AGGAGGAATGGTGAGAGTTCAGG + Intergenic
978285080 4:107067778-107067800 GTGTGCAATGGAGAGGGGGCAGG + Intronic
981011077 4:139925645-139925667 GTCATCAATGGTGAGGGTGAAGG - Intronic
983274614 4:165602374-165602396 GTGAGTAATAGTGAGATTGATGG + Intergenic
983848371 4:172547188-172547210 GTGAGCAGTGGTTAGAATGCAGG + Intronic
985915505 5:2915660-2915682 GTCAGCATCGCTGAGAGTGCTGG + Intergenic
990120403 5:52444182-52444204 GTGACCAAGGGTGGGAGTCCGGG - Intergenic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
994804366 5:104424716-104424738 GTGAGCAGGGGCGAGAGTGTAGG + Intergenic
996087818 5:119322265-119322287 GTGAGCACTGCTGATGGTGCTGG - Intronic
997220932 5:132163291-132163313 GTGAGCAAGGCTGGGGGTGCTGG - Intergenic
998106314 5:139471420-139471442 GAGGGCCATGCTGAGAGTGCAGG + Intergenic
998657072 5:144193310-144193332 ATGAGCAAGGGTGAGAGTGCAGG - Intronic
999123731 5:149230581-149230603 GTGGGACATGGGGAGAGTGCTGG + Intronic
999229941 5:150055912-150055934 GCGAGGGTTGGTGAGAGTGCAGG - Intronic
999493341 5:152073005-152073027 GTGTGCAATGGGGAAAGTGGAGG + Intergenic
1000484570 5:161824649-161824671 GTGACCAACAGTGGGAGTGCTGG - Intergenic
1003032007 6:2609589-2609611 GGCAGCAATGGTAAGAGTGTGGG - Intergenic
1003449708 6:6219328-6219350 GTGAGGAAGGGTGAGGGTGAGGG - Intronic
1004380743 6:15130096-15130118 GTGAGCAAATGTCAGAGTGCCGG - Intergenic
1006550586 6:34819806-34819828 GTGAGAAATAGTGAGAGGACTGG + Intronic
1007383962 6:41508144-41508166 CTGAGCAATGGGGAGAGTCCAGG + Intergenic
1008034594 6:46733200-46733222 ATGTGCAAAGGTGAGAGTGAGGG + Intronic
1008226310 6:48920881-48920903 GGGAGCAAGAGTGAGAGTGGGGG - Intergenic
1011292893 6:85794815-85794837 GTGAGCAAAGGGAAGAGTGGTGG - Intergenic
1015803879 6:137089483-137089505 GTGAGCCAGCCTGAGAGTGCGGG - Intergenic
1016379205 6:143456582-143456604 ATGAGCCATGGTGAGAGGGTTGG - Intronic
1022115222 7:27254988-27255010 GTAAGCAAGAGTGAGAGTGGAGG + Intergenic
1022226128 7:28365379-28365401 GGGAGCAAAGGTGAGGGTGTGGG - Intronic
1022581553 7:31560246-31560268 GTGAGCAAAGATGAGAGTAGAGG + Intronic
1022726616 7:32987106-32987128 GTGAGCAGGGGTGATAGTGGGGG + Intronic
1023046731 7:36216305-36216327 GTGAGCAATGGTGACAGGAGGGG - Intronic
1024976943 7:55122190-55122212 ATGAGCAAGGCTGAGAGTGCTGG - Intronic
1025788499 7:64666276-64666298 CCTAGAAATGGTGAGAGTGCTGG + Intronic
1025801901 7:64794562-64794584 CCTAGAAATGGTGAGAGTGCTGG + Exonic
1025815044 7:64903410-64903432 CCTAGAAATGGTGAGAGTGCCGG + Exonic
1025825369 7:65006528-65006550 CCTAGAAATGGTGAGAGTGCCGG - Exonic
1026111731 7:67463865-67463887 CTGAGCAGTGGTGAGGGTCCTGG + Intergenic
1026522878 7:71132028-71132050 GTGAGCGCTGGTGAGTTTGCCGG + Intergenic
1027429480 7:78095440-78095462 ATGGGAAATGGTGGGAGTGCTGG + Intronic
1035114283 7:156509791-156509813 GTGAGCCATGGTGAGAGGCAGGG - Intergenic
1035812486 8:2504368-2504390 GTGAGCACTGGCGGGACTGCTGG - Intergenic
1037585908 8:20275749-20275771 GTGGGGAAGGGTGAGGGTGCAGG + Intronic
1038072347 8:24031019-24031041 GTGAGCATTGCTGAGACTGGGGG + Intergenic
1039710119 8:40047592-40047614 ATAACCAATGGTGAGATTGCTGG - Intergenic
1040289475 8:46116987-46117009 GAGAGAAGTGGTGAGAGTGCAGG - Intergenic
1040326080 8:46342287-46342309 GGGAGAAGTGGTGAGAGCGCAGG + Intergenic
1040329102 8:46376885-46376907 GTGAGAAGTGGTGAGACTGCAGG + Intergenic
1040329288 8:46377753-46377775 GGGAGAAGTGGTGAGATTGCAGG + Intergenic
1040335259 8:46412823-46412845 GGGAGAAATGGTGAGACTGCAGG + Intergenic
1041497620 8:58504030-58504052 GTCAGCAATGGTGATCTTGCTGG - Intergenic
1041661410 8:60405047-60405069 ATGAGCAAAAGTGACAGTGCTGG - Intergenic
1041960549 8:63610517-63610539 GAGAGCAATGATGACAGGGCAGG + Intergenic
1044464310 8:92485794-92485816 GTGAACAATGGTAAGAGAGGTGG + Intergenic
1046076809 8:109322087-109322109 CTGCCCAATGGTGAGAGTGGAGG + Intronic
1046715350 8:117560979-117561001 CTGAGCTATGGTGAGAGAGGAGG + Intergenic
1047171066 8:122492639-122492661 GTTAGCAAGGGGGAGAGTGCTGG + Intergenic
1047181117 8:122589120-122589142 GTGGGCAAAGGGGAGAGTGGTGG - Intergenic
1047783993 8:128135863-128135885 GTAAGCCATGGTGAGTGTGATGG - Intergenic
1049116863 8:140696354-140696376 GTGAGCATGTGTGAGAGTGCAGG + Intronic
1049130193 8:140832653-140832675 GTGAGAAGTGGTGAGATTGAGGG + Intronic
1049632814 8:143668033-143668055 GTGAGCAACACTGAGTGTGCTGG - Intergenic
1050353349 9:4761006-4761028 GGCAGCAATGCTGAGGGTGCAGG - Intergenic
1050959023 9:11703674-11703696 GAGAGCACGTGTGAGAGTGCAGG - Intergenic
1051165876 9:14261566-14261588 GTGTGCAAGGGGGAGAATGCAGG + Intronic
1051982514 9:23039973-23039995 GAGAGCACTGGAGAGACTGCAGG + Intergenic
1055935098 9:81597439-81597461 GTCATCAAAGGTGAGAGTGGGGG + Intronic
1056046576 9:82724223-82724245 CTGAGGAAGGGAGAGAGTGCAGG - Intergenic
1059929645 9:119248412-119248434 GTGATCAAGGGTAAGAGGGCTGG - Intronic
1060961820 9:127686211-127686233 GTGAGCATTGGAGAGAGACCTGG + Intronic
1187311101 X:18143710-18143732 GTGAGGGATGTTGATAGTGCGGG + Intergenic
1188005323 X:25012767-25012789 GTGAGCAAGGGTGGGTGTGTTGG + Intronic
1189067350 X:37824560-37824582 GTGAGAAATGGAGAGAATGATGG - Intronic
1189252257 X:39610443-39610465 TTGAGGAATGGTGAGCCTGCTGG - Intergenic
1189340218 X:40199267-40199289 AGGAGAAATGGTGAGAATGCTGG - Intergenic
1195741254 X:108066892-108066914 GTGAGAACTGGAGAGAGTCCAGG - Intronic
1196834740 X:119803614-119803636 GTGAGCAAGAGAGTGAGTGCGGG - Intergenic
1196835895 X:119813392-119813414 GTGAGCAAGAGAGTGAGTGCGGG - Intergenic
1196837931 X:119830402-119830424 GTGAGCAAGAGAGTGAGTGCGGG - Intergenic
1201342749 Y:12951957-12951979 GTGAGCAATGGACAGAGAGGAGG - Intergenic
1202599334 Y:26576679-26576701 GGGAGCAATAGTGAGAGAGAGGG + Intergenic