ID: 910865397

View in Genome Browser
Species Human (GRCh38)
Location 1:91783654-91783676
Sequence GCTCAAAAGTTGCTGGTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910865397_910865399 25 Left 910865397 1:91783654-91783676 CCAATGACCAGCAACTTTTGAGC 0: 1
1: 0
2: 0
3: 11
4: 102
Right 910865399 1:91783702-91783724 CTTGAGTCCAGAGTAAACAAAGG 0: 1
1: 0
2: 1
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910865397 Original CRISPR GCTCAAAAGTTGCTGGTCAT TGG (reversed) Intronic
904163424 1:28537542-28537564 TCTCAAAGGTGGCTGGTCCTGGG + Intronic
905683793 1:39894154-39894176 GCCTCAGAGTTGCTGGTCATGGG + Intergenic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
907823638 1:57994574-57994596 GCCCCAAAGCTGCTGGTCCTAGG - Intronic
910865397 1:91783654-91783676 GCTCAAAAGTTGCTGGTCATTGG - Intronic
911742320 1:101400499-101400521 GCTCAAAGATGACTGGTCATGGG + Intergenic
912370818 1:109172773-109172795 GCTGGAAAGCTGCTGGTCTTTGG - Intronic
916827340 1:168455047-168455069 GCTCAAAAGTTTTTACTCATGGG + Intergenic
919134812 1:193494346-193494368 TCTCAAGAGTTGCTGGCAATAGG - Intergenic
923746580 1:236706423-236706445 GTTCAAATGGTGGTGGTCATGGG + Intronic
1062996209 10:1869621-1869643 GCTGACAAGTTGGTGGTGATTGG + Intergenic
1067176171 10:43947802-43947824 ACTCAACAGTTGATGGACATTGG + Intergenic
1071241404 10:83709423-83709445 GCAAAAAAGTTGCAGGTGATAGG - Intergenic
1071315330 10:84390018-84390040 ATTGAAAAGTTGCTGCTCATAGG + Intronic
1074715306 10:116212783-116212805 ACTCGAATGTTGCTGGACATTGG + Intronic
1074859601 10:117500299-117500321 GCACAAAAGTTACTGGTAATGGG + Intergenic
1075385812 10:122054594-122054616 GGTCAAAAATTGTTGGTCATTGG + Intronic
1078620018 11:12898722-12898744 GCTCAGAAGGTGCTTGGCATAGG - Intronic
1079487846 11:20953978-20954000 GCTTAAAATTTGCTGTTCTTAGG + Intronic
1080200013 11:29657925-29657947 GCTGAAAGGCTGCTGGTCAAGGG - Intergenic
1081334047 11:41842439-41842461 GCTGAGAAGTGGCTGGTCATCGG + Intergenic
1081672061 11:44948014-44948036 GCTCAGAAGGGACTGGTCATAGG + Intronic
1088227194 11:107634178-107634200 GCTCAAAAATGGCTGAACATTGG - Intronic
1092213308 12:6662656-6662678 CCTCAAAAGTGGCTTCTCATGGG - Intronic
1094189179 12:27679686-27679708 GCTTAAAAGTGGCTGGACATGGG + Intronic
1094324654 12:29223752-29223774 TCTGAAAAGCTGCTGGTCTTGGG + Intronic
1097369134 12:58754702-58754724 ACTGAAAAGATGCTGGTCATGGG + Intronic
1102587581 12:113933823-113933845 GCTCAAAAGTTCCTGGGGAAGGG + Intronic
1103063415 12:117877074-117877096 GCTCAAAAGTTTCCGATTATTGG + Intronic
1107855689 13:44613387-44613409 GTTCAAAAGTTGATGGAAATAGG + Intergenic
1108617734 13:52150712-52150734 TCTCAAATGTTGCTGTACATTGG + Intronic
1109571185 13:64192415-64192437 GCTCAAAACTCACTGGACATTGG - Intergenic
1110617889 13:77561573-77561595 GCTCCAAAGTGGCTGTTCAGTGG - Intronic
1111823760 13:93243931-93243953 ACTCAGATGTTGCTGGTGATGGG + Intronic
1114303504 14:21399616-21399638 GCTGACAAGTCGCTGCTCATTGG - Exonic
1118904783 14:70015960-70015982 GCTTAAAAGTTTCTGGTCTGGGG + Intronic
1122498727 14:102179172-102179194 GCTGAAAGGTTGCTGCTTATTGG - Intronic
1123486901 15:20748869-20748891 GCTCAAAAGTTTTTGGTGATGGG + Intergenic
1123543388 15:21317925-21317947 GCTCAAAAGTTTTTGGTGATGGG + Intergenic
1125407970 15:39372596-39372618 TCTCGAAAGTTTCTAGTCATTGG - Intergenic
1126332320 15:47546664-47546686 GGCCACAAGGTGCTGGTCATGGG - Intronic
1127714329 15:61634044-61634066 GTTCCAAAATTGCTGGTCTTTGG - Intergenic
1128653629 15:69440796-69440818 GCTCATGAGTTGCTGGCCGTTGG - Exonic
1128902245 15:71435039-71435061 GCACAACAGTAGCTGTTCATGGG + Intronic
1130313957 15:82779286-82779308 GCCCTCAAGTTGCTGATCATGGG + Intronic
1202951709 15_KI270727v1_random:45052-45074 GCTCAAAAGTTTTTGGTGATGGG + Intergenic
1134898754 16:17915068-17915090 AATCAAAAGTTCCTGATCATTGG - Intergenic
1137844711 16:51675774-51675796 GCCCAAATGTGGCTGGCCATAGG - Intergenic
1138149156 16:54639284-54639306 GCTCTAAAATTGCTGGTTCTTGG - Intergenic
1138394106 16:56691166-56691188 GGGCAAAAGTGGCTGGTGATGGG - Intronic
1143332240 17:6146141-6146163 GCTCAGGAGATGCTGTTCATTGG + Intergenic
1143449162 17:7025424-7025446 TCTCAAACTTTGCTGCTCATTGG - Intronic
1150008262 17:61482993-61483015 GCTCAGCATTTGCTGGTCGTAGG - Exonic
1155800374 18:30094118-30094140 GATTAAAAGATGCTGGTCTTAGG - Intergenic
1157311446 18:46556412-46556434 CCTCAAGAGTTGCTGGTCTGGGG + Intronic
1157421677 18:47553118-47553140 GCTCAACAGTTGCTGGAGTTTGG - Intergenic
1158391549 18:57049163-57049185 GCCCAGAGGTTGCTGGTCAGCGG - Intergenic
1159667519 18:71179970-71179992 GCTCATGAATTGCTGGTCATAGG - Intergenic
1166689487 19:44814028-44814050 GGTCAAAGGTTACGGGTCATAGG - Intronic
931040550 2:58293792-58293814 GAGCAAAAGAAGCTGGTCATCGG - Intergenic
931816936 2:65913812-65913834 TTTCTAAAGTTGCTGGGCATTGG + Intergenic
934844311 2:97652557-97652579 GTTCAAAAGTGGCAGGTCATGGG - Intergenic
935302823 2:101708091-101708113 GCTAAAAAGTGGATGGTCAGAGG - Intronic
937378331 2:121353265-121353287 GCTCCCAAGTTGCTGGGGATCGG + Intronic
941150788 2:161912915-161912937 GCACAAAAATAGCTGGACATAGG - Intronic
946965816 2:225036593-225036615 GATCTAATGTTGCTGGTCCTTGG + Intronic
1170522849 20:17206246-17206268 GCCCAAAAGCTGCTGTTAATTGG - Intergenic
1172856333 20:38006299-38006321 TCTCAAGAGCTGCTGGTCTTTGG + Exonic
1174157603 20:48526536-48526558 GCTCAAAAGATGATGGAAATTGG + Intergenic
1175561038 20:59931551-59931573 CCTCAACAGTTGCTGGCCCTAGG - Intronic
1177763703 21:25432892-25432914 TATCCAAAGTTGCTGGTTATGGG + Intergenic
1178388866 21:32182106-32182128 GCTCCAAGGAAGCTGGTCATAGG - Intergenic
1182994298 22:34798715-34798737 ACACAAAAGTCACTGGTCATGGG + Intergenic
1185233794 22:49699633-49699655 CCTCACATGTTGCTGGTCAGTGG + Intergenic
949841326 3:8323652-8323674 GGACAAAAGTTGCTGTTAATTGG - Intergenic
950621289 3:14207579-14207601 TCTCAAAAGTTGGTGTGCATGGG - Intergenic
957876544 3:86154283-86154305 GCTCAAAAGAGGGTGGTCAGTGG + Intergenic
959783433 3:110264596-110264618 GCTCAATATTTACTGGTCAAAGG + Intergenic
964530939 3:157667227-157667249 GCTCAAAAGTTGTTGAACAATGG - Intronic
965493101 3:169364101-169364123 GCTCAAAAGTTGCTGAGTACAGG - Intronic
965819469 3:172669948-172669970 TCTTAAAAGTTCCTGTTCATTGG - Intronic
966600576 3:181771065-181771087 GATCAAAAGGTGGTGGTCACAGG - Intergenic
968432507 4:567053-567075 GCACATAAGATGCAGGTCATAGG - Intergenic
969711301 4:8845741-8845763 GCTCAAAAGTGCCTGGCCAAGGG + Intergenic
971422166 4:26483304-26483326 GGTCTAAAGTTGCTGGTTATTGG - Intronic
971553684 4:27984734-27984756 GCTGAAATGTTGCTTCTCATAGG + Intergenic
972723222 4:41721782-41721804 GCTGAAAAATTGCTTCTCATTGG - Intergenic
972945352 4:44247600-44247622 GGTAAAAAGTTGCTGTTCAATGG - Intronic
974570733 4:63645100-63645122 CCTCAAAAGTAGATGGTGATTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976591987 4:86858549-86858571 GCTCATCAGTTGATGGTCACAGG - Intergenic
979271972 4:118773267-118773289 GCTAAGCAGTTACTGGTCATGGG + Intronic
987705829 5:21461256-21461278 GCTCAACAGTTCCTTGTTATAGG + Intergenic
990687562 5:58323276-58323298 GCTAAGAAGTTTCTGCTCATTGG - Intergenic
996834067 5:127771798-127771820 GCCTAAACCTTGCTGGTCATTGG - Intergenic
997596399 5:135110024-135110046 GCTCAACAGTTCCTGCTCCTTGG + Intronic
998628457 5:143872206-143872228 TCTACAAAGTTGCTGGTCTTTGG + Intergenic
1002276242 5:178106081-178106103 GTCCAAAAGGTGCTGGCCATGGG - Intergenic
1019339848 7:503793-503815 GCTCAACAGTTGCAGGGCGTGGG + Intronic
1019649623 7:2149802-2149824 GCTCAGCTGTTGCTGATCATCGG - Intronic
1021180673 7:17501603-17501625 GTTCAAAATTGGCTGGACATTGG + Intergenic
1024809333 7:53189235-53189257 GCAAAAAAGTTACAGGTCATGGG + Intergenic
1026870902 7:73850838-73850860 GCTCATAAATGGCTGGGCATGGG - Intergenic
1027629394 7:80583856-80583878 ACTCAAGAGCTCCTGGTCATGGG + Intronic
1039768245 8:40654120-40654142 GCTCAACATCTGCTAGTCATAGG + Intronic
1041728657 8:61042997-61043019 GTTCAAAAGCTGTTGGTTATAGG + Intergenic
1042191063 8:66187672-66187694 GCTATAAAGTTCCTGGTCAGAGG + Intergenic
1042526139 8:69766799-69766821 CCTCAAGAGATGCTGGTCAGTGG + Intronic
1043248170 8:78032995-78033017 CCTTAATAGTTCCTGGTCATAGG - Intergenic
1044699224 8:94950594-94950616 GATCAAAATATGATGGTCATTGG + Intronic
1053292702 9:36892073-36892095 GCTCAACAGTTGCTGGTTCCGGG - Intronic
1060718499 9:125956934-125956956 CCTCAAAGGCTGCAGGTCATGGG - Intronic
1188285948 X:28325775-28325797 GCTCAAAAGTTCCAGATCACAGG + Intergenic
1202025749 Y:20520828-20520850 GCTCAAAATTTGCTTTTTATGGG - Intergenic