ID: 910872270

View in Genome Browser
Species Human (GRCh38)
Location 1:91845663-91845685
Sequence GGTCAGGGTATACTACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910872270 Original CRISPR GGTCAGGGTATACTACATGC AGG (reversed) Intronic
905391292 1:37637134-37637156 GGTCAGGCTAAACTTCATACAGG - Intergenic
907359366 1:53902478-53902500 GATGAGAGTATACTACATTCTGG + Intronic
907824946 1:58006718-58006740 GGTCAGAGTATCCTTCTTGCAGG - Intronic
910872270 1:91845663-91845685 GGTCAGGGTATACTACATGCAGG - Intronic
917512391 1:175679146-175679168 GGTCAGGGTAAAGTACAGGAGGG + Intronic
920193595 1:204211603-204211625 GGTAAGAGTATATTACTTGCAGG + Intronic
1067152185 10:43745860-43745882 TGTCAGGTTCTATTACATGCCGG - Intergenic
1079509632 11:21196082-21196104 GGTCAGAGTGTACAACTTGCAGG - Intronic
1080776326 11:35390344-35390366 TATCAGGGTACACTACATGTAGG - Intronic
1088167060 11:106951394-106951416 AGTCAGGGAATAGTAGATGCTGG - Intronic
1088515706 11:110631098-110631120 TTTCAGGGTAAACTACATACAGG + Intronic
1088828338 11:113514678-113514700 GGTCAGGGAAGACTTCATGGAGG + Intergenic
1101650371 12:106672177-106672199 TGTAAGGGTATCCTGCATGCTGG + Intronic
1105565731 13:21545712-21545734 GGACAGAGTATACTAGAGGCTGG + Intronic
1108700904 13:52943427-52943449 CGTCAGGGTCTGCTACCTGCAGG + Intergenic
1111384690 13:87509196-87509218 GGGCAGGTTACACTTCATGCTGG - Intergenic
1114636830 14:24192268-24192290 GGTCAGGGCATACAACAAGATGG + Exonic
1119184401 14:72629705-72629727 GTTCAGGGTAAACTGCAGGCAGG + Intronic
1121928157 14:97948083-97948105 GGTCAGACTATTCTACCTGCTGG + Intronic
1127684260 15:61326527-61326549 GGTCAGTGTACAATACATGTTGG - Intergenic
1130639501 15:85658195-85658217 ATTCAGGTTATACTACATGCAGG - Intronic
1135325588 16:21523520-21523542 GCTCAGGGTCTTCTACCTGCTGG - Intergenic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1137473778 16:48788786-48788808 GGTCATGTTATAGTACATGGTGG - Intergenic
1138186686 16:54982737-54982759 GGTCAAGGTTTACTGCATGACGG - Intergenic
1142038586 16:87878098-87878120 GCTCAGGGTCTTCTACCTGCTGG - Intergenic
1146514349 17:33477764-33477786 GGTCAGGGTAGGCTTCCTGCTGG + Intronic
1147399469 17:40171446-40171468 GGACAGGGTAGACTGCTTGCTGG - Exonic
1149638595 17:58189349-58189371 GGTCAGGGCCAACCACATGCAGG - Intergenic
1158250254 18:55479799-55479821 AGTCAGGGTATGCTAATTGCTGG - Intronic
1160413110 18:78688220-78688242 GGACAGAGAATACCACATGCTGG - Intergenic
1166826218 19:45610932-45610954 GGGAAGGCTATTCTACATGCTGG + Intronic
929399560 2:41564222-41564244 GGTCAGGGTAAACTTCCTGAAGG - Intergenic
938275870 2:130021721-130021743 AGTCAGGATACAATACATGCTGG + Intergenic
940359238 2:152779723-152779745 AGTCAAGGTATACAACATGATGG + Intergenic
945462281 2:210123030-210123052 GGTCAGGGAATAAAACATGCTGG + Intronic
1174190297 20:48735611-48735633 GGGCAGCCTGTACTACATGCTGG - Intronic
1176231425 20:64035001-64035023 GTTCAGGGGATACTTCCTGCAGG + Intronic
1180910119 22:19444076-19444098 TGTCAGGGTATCCTGCATGCAGG + Exonic
954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG + Intronic
956198536 3:66679012-66679034 GCCCAGGGTATACTACATCTTGG + Intergenic
963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG + Intronic
964465156 3:156983778-156983800 GGGCAGGGTATGCTACCTGGTGG - Intronic
967459073 3:189724424-189724446 GTTCAGTGTATACTACTTGGGGG - Intronic
978072922 4:104493370-104493392 GTTCAGGGAATTCTACATGGGGG + Intronic
980250006 4:130302781-130302803 GGTCAGGGTAGGCTAAGTGCTGG + Intergenic
980459952 4:133096741-133096763 GGTGAGCGTATACTACCTGAGGG - Intergenic
981163350 4:141525734-141525756 AGTCAGGGTCTTCTAAATGCAGG + Intergenic
982859825 4:160434816-160434838 GGTCAGGGCATCCTAGATGATGG - Intergenic
995399657 5:111726668-111726690 GGTCAGGTTAAGCTATATGCAGG - Intronic
996631392 5:125637228-125637250 GGTCAGTGGATTCTATATGCAGG + Intergenic
1002325736 5:178404397-178404419 GGGCAGGGCACACTTCATGCAGG + Intronic
1014831457 6:126107387-126107409 TGTCAGGGTATCCTGCAAGCAGG - Intergenic
1016775427 6:147899591-147899613 CGGCAGGGTCTACTACCTGCTGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025086716 7:56029329-56029351 GGCCAGGGTAGAAGACATGCCGG + Intronic
1028669423 7:93384084-93384106 GGTCAGGACATAGGACATGCAGG + Intergenic
1032694494 7:134322515-134322537 CCCCAGGGTATCCTACATGCTGG + Intergenic
1035460492 7:159035616-159035638 GCTCCGGGTAAACAACATGCAGG + Intronic
1039338097 8:36616492-36616514 GGACAGAGAATACTACAGGCTGG + Intergenic
1039380423 8:37079833-37079855 GGTCAGGCTGTTCTACATCCTGG + Intergenic
1052455663 9:28693952-28693974 GGTCAGTGTATAATACTTGTTGG - Intergenic
1053255473 9:36613627-36613649 GGTCAGGATAAACTTCATGGAGG + Intronic
1056411410 9:86331267-86331289 CATCAAGATATACTACATGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1193421610 X:81290064-81290086 GGTCAGGCAATAATACATGCTGG + Intronic
1199429687 X:147745178-147745200 GCTGAGGGTGTACCACATGCAGG - Intergenic