ID: 910872965

View in Genome Browser
Species Human (GRCh38)
Location 1:91851899-91851921
Sequence CTGAATGTGCATATAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910872965_910872973 30 Left 910872965 1:91851899-91851921 CCCTCCACTATATGCACATTCAG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 910872973 1:91851952-91851974 TGAAAATGATAAAAAGGGCCAGG No data
910872965_910872971 25 Left 910872965 1:91851899-91851921 CCCTCCACTATATGCACATTCAG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 910872971 1:91851947-91851969 CTCCTTGAAAATGATAAAAAGGG 0: 1
1: 0
2: 3
3: 43
4: 509
910872965_910872970 24 Left 910872965 1:91851899-91851921 CCCTCCACTATATGCACATTCAG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 910872970 1:91851946-91851968 TCTCCTTGAAAATGATAAAAAGG 0: 1
1: 0
2: 0
3: 47
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910872965 Original CRISPR CTGAATGTGCATATAGTGGA GGG (reversed) Intronic
902199016 1:14820137-14820159 CTGAATCTGCATATTTGGGAAGG - Intronic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
906696176 1:47824888-47824910 GTGAATATGCATATGTTGGAGGG - Intronic
908637727 1:66186928-66186950 CTGAATGGGCACAAACTGGAAGG - Intronic
908707636 1:66977080-66977102 CTGTATGTGCTTATACTGAATGG - Intronic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
910676039 1:89817945-89817967 CTGTGTCTTCATATAGTGGAAGG - Intronic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
910978520 1:92934580-92934602 CTGAGTCAGCATATACTGGAAGG + Intronic
913608807 1:120491220-120491242 CTGAATGAGCTTCTAGTAGAGGG - Intergenic
914582389 1:149030618-149030640 CTGAATGAGCTTCTAGTAGAGGG + Intronic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
916826591 1:168447839-168447861 CTGGATGTGGAGATAGGGGAAGG - Intergenic
917067541 1:171113177-171113199 ATGAATGTGAATACAGTTGAAGG - Intronic
917680709 1:177363957-177363979 ACTGATGTGCATATAGTGGAAGG - Intergenic
921184935 1:212662075-212662097 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1077708581 11:4513064-4513086 CAGAGTGTGCATATAGTGCGGGG - Intergenic
1080215493 11:29835344-29835366 CTGTCTGGGCATATGGTGGAGGG + Intergenic
1080547615 11:33336446-33336468 CTGAATGGGAATAGAGAGGAAGG - Intronic
1081064351 11:38521646-38521668 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1082681902 11:56184133-56184155 CTGTGTCTTCATATAGTGGAAGG + Intergenic
1084535604 11:69754598-69754620 CTGAATGAACATGGAGTGGAGGG - Intergenic
1087334701 11:96829025-96829047 CTGAATGTGAATAACTTGGATGG + Intergenic
1090975478 11:131676521-131676543 CTGCATATGCACATAGTGGAGGG + Intronic
1091647273 12:2283459-2283481 CTGAGTGTGGATATAGAGTAAGG - Intronic
1093740592 12:22680902-22680924 CCCAGTGTGCATATAATGGAGGG - Intronic
1093761146 12:22912850-22912872 GTGAAGCTGCATATAGTAGAAGG + Intergenic
1094104184 12:26792270-26792292 CTGAATTTGAAGATAATGGAAGG + Intronic
1094709267 12:32944881-32944903 CTTATTGGGCATATTGTGGAGGG + Intergenic
1095220608 12:39609146-39609168 CTTAATGTGCATTGAATGGATGG + Intronic
1096920391 12:55078918-55078940 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1097585850 12:61515506-61515528 CTGAATGTGCCTATGGTGTCAGG - Intergenic
1098777914 12:74645126-74645148 GTTAATGTACATATAGTAGATGG - Intergenic
1099028447 12:77495000-77495022 TTGAATGTGCAGACAGTGGGAGG + Intergenic
1099307136 12:80971490-80971512 CTTAATTTGCATATAGTCTAAGG - Intronic
1099737448 12:86588043-86588065 CTGAATGGGCACAAACTGGAAGG - Intronic
1100196454 12:92251668-92251690 CTTAATGTGCATATAGCACATGG - Intergenic
1100224600 12:92543247-92543269 CTCAGTCTGGATATAGTGGAAGG - Intergenic
1101356887 12:103987592-103987614 CTGAGTGTGCATATAGCTCAGGG - Exonic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1107742721 13:43469639-43469661 GTGTATGTTCATATATTGGAAGG + Intronic
1108565428 13:51692288-51692310 CTGAATGGGCAAAAACTGGAAGG - Intronic
1111710828 13:91812065-91812087 CTGACTGTGAATAAAGTGGCAGG + Intronic
1111925295 13:94457375-94457397 CTGCATCCTCATATAGTGGAGGG - Intronic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112651598 13:101405133-101405155 GTAAATGTGCATATAGGGAAAGG - Intronic
1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG + Intergenic
1115167505 14:30465337-30465359 CTGTATTTCCATATAGTGGGTGG + Intergenic
1116026681 14:39523651-39523673 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1116226059 14:42153770-42153792 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1116708055 14:48328480-48328502 CTGATTGAGCATACAGTGGAAGG - Intergenic
1117640186 14:57790041-57790063 CTGAATGGGCAAAAACTGGAAGG + Intronic
1118648328 14:67862934-67862956 ATAAATATGCATATATTGGAGGG + Intronic
1120113730 14:80589096-80589118 CTGATTTTGAATATAGAGGAAGG + Intronic
1121206045 14:92168474-92168496 GTGCATGTGCGTATAGTGGTGGG - Exonic
1121888941 14:97571516-97571538 CAGAATGTGTATATTGAGGAGGG - Intergenic
1126728194 15:51654626-51654648 GGGAATGTTCATATATTGGAAGG - Intergenic
1126735397 15:51727482-51727504 CTGAATGTGGGCATAGTTGAGGG - Intronic
1127983154 15:64048733-64048755 CTGGATGTGCATGCAGAGGAGGG - Intronic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1133642183 16:7727635-7727657 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1137371814 16:47913895-47913917 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1139201627 16:64983506-64983528 CTGAATGGGCATATAGTCATGGG + Intronic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1145102448 17:20088349-20088371 CTGAATGGGCATTAAGTGGTAGG + Intronic
1146237456 17:31180642-31180664 CTGAATGGGCAAAAACTGGAAGG + Intronic
1146698096 17:34927194-34927216 CTGTTTGTGCATATAGGAGAAGG - Intergenic
1148487507 17:48000303-48000325 CTCATTCTGCATGTAGTGGAAGG + Intergenic
1149445214 17:56708051-56708073 CTGAATGTGGAGAGAGTTGATGG + Intergenic
1154209110 18:12364113-12364135 GGGAATGTGCATATCGTGTAGGG - Intronic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1158135583 18:54204171-54204193 CTGACAGTGAACATAGTGGAGGG - Intronic
1158725922 18:59971963-59971985 CTGAAAGTGGATATTTTGGAAGG - Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1159748980 18:72277045-72277067 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1166448088 19:42875950-42875972 CTGGATGGGAATACAGTGGAAGG + Intronic
1166452484 19:42914166-42914188 CTGGATGGGAATACAGTGGAAGG + Intronic
929041377 2:37747932-37747954 TTGAATGTGCAAGTAGTTGATGG - Intergenic
929292298 2:40207385-40207407 CTGAATGGCAATATATTGGATGG + Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
934143412 2:89070208-89070230 CTGAATGTGTTTATATTGAATGG - Intergenic
934225826 2:90130347-90130369 CTGAATGTGTTTATATTGAATGG + Intergenic
936919709 2:117675318-117675340 CTGAATGTGAAGAGAGTGAATGG - Intergenic
936943372 2:117908535-117908557 CTGAATGTGCATTTTATGAAGGG - Intergenic
937700482 2:124858101-124858123 CTGAATGGGCAAAAACTGGAAGG + Intronic
937834032 2:126453466-126453488 CTGAATGGGCAAAAACTGGAAGG - Intergenic
938651164 2:133385141-133385163 CTGAATGGGCAAAAACTGGAAGG - Intronic
938684583 2:133725366-133725388 TTGAATGTGAATATAATGGCTGG - Intergenic
939393357 2:141597581-141597603 CTGCATGTTCTTATATTGGAAGG + Intronic
940673944 2:156705785-156705807 CTCATTGTCCATATAGTTGAGGG + Intergenic
941440770 2:165532606-165532628 CTGAATGGGCAAAAACTGGAAGG + Intronic
942222197 2:173781005-173781027 CTGAAAGGGAATCTAGTGGAAGG + Intergenic
944748746 2:202685720-202685742 CTGGATATCCATATAGGGGAGGG + Intronic
945351721 2:208788316-208788338 CTGAATGGGCAAAAATTGGAAGG + Intronic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
947727831 2:232410748-232410770 CTGAATGTGGACACAGTGGCTGG + Intergenic
1170897847 20:20432257-20432279 CTCATTGTGCCTGTAGTGGAGGG + Intronic
1172146350 20:32761098-32761120 CTCCAAGTGCTTATAGTGGATGG - Intergenic
1172148270 20:32772627-32772649 CTCAAAGTGGATATAGGGGAAGG + Intronic
1173714493 20:45190512-45190534 CAGAATTAGCATATTGTGGAGGG - Intergenic
1176590728 21:8647697-8647719 CTGAATCGGACTATAGTGGATGG - Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1182128262 22:27832249-27832271 CTGAATGTGCACAGACAGGAGGG + Intergenic
1182910800 22:33982449-33982471 CAGAATGTTCCTGTAGTGGAGGG + Intergenic
949136539 3:573983-574005 CTGAATCGGACTATAGTGGATGG + Intergenic
950480781 3:13242521-13242543 CGGGATGTGCAGCTAGTGGAAGG - Intergenic
950931298 3:16791577-16791599 CTGAATGGGCAAATAGTATAAGG + Intergenic
952012497 3:28916554-28916576 ATGATTGTGCATATACTTGAAGG - Intergenic
952354859 3:32574643-32574665 ATGAAAGTGCAAATAATGGAAGG - Intergenic
953596268 3:44317608-44317630 CTGAATGTGCATATGTCAGAAGG + Intronic
954702374 3:52456879-52456901 CTGAATGTGCCCATAGCTGATGG - Intronic
954854981 3:53636087-53636109 GTGGATGTGTATATGGTGGAGGG + Intronic
957092774 3:75748738-75748760 CTGAATGGGCAAAAACTGGAAGG + Intronic
957442733 3:80271458-80271480 ATGTATGTGCATATAGAGGCAGG + Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
961714408 3:128848812-128848834 CTTGATGTGCATAGAGTAGAAGG + Intergenic
961908604 3:130289554-130289576 TTTAATGTGCATTTAGTTGATGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966358365 3:179106784-179106806 CTGAATGTGGAATTAGTTGAAGG - Intergenic
967843606 3:194027268-194027290 CTTAATTTGCATATAGTTAAAGG - Intergenic
969965157 4:10986474-10986496 CTGTGTCTTCATATAGTGGAAGG - Intergenic
973621182 4:52727694-52727716 CTGAATGTGAATGTGGTGGCTGG + Intronic
974504183 4:62746899-62746921 CTGAATGGGCAAAAACTGGAAGG + Intergenic
974759466 4:66256365-66256387 CTGAATGGGCAAAAACTGGAAGG - Intergenic
974986096 4:69027288-69027310 CCAAATGTACATTTAGTGGAAGG - Intronic
977723186 4:100264626-100264648 CTGAATGGGCAAAAACTGGAAGG - Intergenic
979140465 4:117166255-117166277 CTACATGTGCATATGTTGGAGGG + Intergenic
979896643 4:126166008-126166030 CTGAATGGGCAAAAACTGGAAGG - Intergenic
980803425 4:137782710-137782732 CTGAATGTGATTACTGTGGATGG - Intergenic
982130869 4:152227635-152227657 CTCAATGTGCATATCGTACATGG - Intergenic
982405779 4:155018729-155018751 TTTAAAGTGCATATAGTGAAGGG + Intergenic
983418428 4:167487582-167487604 ATGAATGTGTAAATTGTGGATGG + Intergenic
986335705 5:6753847-6753869 CTGAATGTGTCTATCGGGGATGG - Intronic
986591912 5:9379770-9379792 CAGAATGTGCATTTAGATGACGG + Intronic
987445730 5:18017069-18017091 CAGAATGTGGATATAATGGCTGG - Intergenic
987452438 5:18102922-18102944 CTGAATGTGCCTGTAGGGGGTGG + Intergenic
987828318 5:23062525-23062547 CTGCATCCTCATATAGTGGAAGG + Intergenic
987969744 5:24927243-24927265 CTCCATCTTCATATAGTGGAAGG - Intergenic
988226752 5:28423025-28423047 CTGAATGTGTACATAGTTTACGG - Intergenic
989412583 5:41137418-41137440 CTGAATGGGCAAAAACTGGAAGG + Intergenic
990385260 5:55254180-55254202 TTGAATGTGCATGTAGTTGTGGG + Intergenic
997070053 5:130611050-130611072 CTGAATGGGCAAAAACTGGAAGG + Intergenic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
999410158 5:151343539-151343561 CAGGATGTGCATACAGTGGCAGG + Exonic
999951306 5:156654040-156654062 GTGAATCTGCAGATAGTGAAAGG - Intronic
1003487918 6:6595535-6595557 CTGGATGTGCGTAGAGAGGATGG - Intronic
1007792610 6:44320419-44320441 CTGAATGTGCAAACAGTAGCTGG - Intronic
1008321908 6:50124745-50124767 CTCAATGTGCTCATAGTGGTGGG - Intergenic
1013871467 6:114766837-114766859 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1014302664 6:119701833-119701855 CTGTGTGTTCATATAATGGAAGG - Intergenic
1021996767 7:26186342-26186364 CTGAATGTGGATATTTTGGAAGG - Exonic
1027560826 7:79727961-79727983 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1028493623 7:91441021-91441043 CTGAGGCTGCACATAGTGGAGGG - Intergenic
1031305794 7:120125067-120125089 CTGAATGTCCATATAGAACAGGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1036238327 8:7061713-7061735 GTGAATGTCCATATTATGGATGG - Intergenic
1036238604 8:7063960-7063982 GTGAATGTTCATATTATGGATGG + Intergenic
1039124567 8:34186972-34186994 CTGAATGTGCAGATAAAAGATGG + Intergenic
1039396346 8:37228343-37228365 CTCAATGTGCATTTACTTGAGGG + Intergenic
1040091098 8:43399706-43399728 TTGAATTTGTATATGGTGGAAGG + Intergenic
1040537123 8:48320136-48320158 CCAAATGTGCCCATAGTGGAAGG - Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040671252 8:49693325-49693347 TTGAATAAGCATATAGTGTAAGG - Intergenic
1040685862 8:49872248-49872270 CTGAATATCCATATCGTGTATGG - Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1043234053 8:77838704-77838726 CTTACTATGCATATAGTGTAAGG + Intergenic
1045726682 8:105182135-105182157 CTGAATGGGCAAAAACTGGAGGG - Intronic
1046086982 8:109449973-109449995 GTTAATGTACATAAAGTGGATGG + Intronic
1049978728 9:884417-884439 CTGAATGTGCAGAAAGTAAACGG + Intronic
1053041221 9:34874290-34874312 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1053139375 9:35673296-35673318 CACAATGTGCATATCGTGGCAGG + Intronic
1058482084 9:105406098-105406120 ATGAATGTGCAAAGACTGGAAGG + Intronic
1059793371 9:117664453-117664475 CTGCATCGTCATATAGTGGAAGG + Intergenic
1203620741 Un_KI270749v1:126421-126443 CTGAATCGGACTATAGTGGATGG - Intergenic
1188665570 X:32816219-32816241 GTGAAAGTGGTTATAGTGGAGGG - Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1192973437 X:76257471-76257493 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1193035000 X:76939915-76939937 CTGAATGTTCAAAAACTGGAAGG - Intergenic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1195698422 X:107683945-107683967 CTGAATGTGCATATAATAGGAGG + Intergenic
1196475222 X:116076624-116076646 TTGATTTTGTATATAGTGGAAGG - Intergenic
1199343290 X:146708037-146708059 CTGAAGGAGAATTTAGTGGATGG + Intergenic
1200007096 X:153094180-153094202 CTGCATCAGCATATAGTGGAAGG + Intergenic
1200813802 Y:7511028-7511050 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1201238641 Y:11936234-11936256 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1201464854 Y:14269361-14269383 CTGAATGGGCAAAAACTGGAAGG - Intergenic