ID: 910874652

View in Genome Browser
Species Human (GRCh38)
Location 1:91867267-91867289
Sequence CCCGTGCCTACCAGTACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910874652_910874658 5 Left 910874652 1:91867267-91867289 CCACCTGTACTGGTAGGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG 0: 1
1: 0
2: 0
3: 1
4: 51
910874652_910874657 -2 Left 910874652 1:91867267-91867289 CCACCTGTACTGGTAGGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 910874657 1:91867288-91867310 GGGGAAGCAGTACGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910874652 Original CRISPR CCCGTGCCTACCAGTACAGG TGG (reversed) Intronic
900596112 1:3480897-3480919 CCTGTGCCCATCAGTCCAGGTGG - Exonic
901813143 1:11779006-11779028 CCCGTGCCTGCCAGAGCAGAAGG - Exonic
902502234 1:16918611-16918633 CACCTGCCCACCAGAACAGGGGG - Intronic
905822761 1:41006616-41006638 CATGTGCCTAACAGTACAGCGGG - Intronic
907461228 1:54606994-54607016 CCCTTGCTGAGCAGTACAGGGGG + Intronic
908824989 1:68124573-68124595 GCCGTGCCTCCCAGTCCAGCAGG - Intronic
910874652 1:91867267-91867289 CCCGTGCCTACCAGTACAGGTGG - Intronic
915311604 1:155008236-155008258 CCCCTGCCAACCAGGCCAGGGGG - Intronic
919941325 1:202288528-202288550 CCAATGCCTCCCAGTACAGATGG - Intronic
920912308 1:210230510-210230532 CCTGTGTCTACAAGTACAAGAGG - Intergenic
920964709 1:210692206-210692228 CCCATGCCCACCAGTCTAGGAGG - Intronic
922625721 1:227039648-227039670 CCAGTGCCTAGAAGTACAGTGGG + Intronic
1067702596 10:48584462-48584484 CCCTCCCCTACCAGGACAGGTGG + Intronic
1073511370 10:104044746-104044768 CCCGTGACTTCCAGTCCAAGGGG - Intronic
1076347147 10:129786989-129787011 CCCGTGCCGTCCAGCACTGGGGG + Intergenic
1076469636 10:130709597-130709619 CCCATGCATGCCAGTACAGCAGG + Intergenic
1076635080 10:131876408-131876430 CCCGTGCCTACCGGAGGAGGGGG - Intergenic
1076888299 10:133272459-133272481 GCCGTGCCTGCCAGGTCAGGAGG + Exonic
1101559636 12:105844225-105844247 TCAGTGCCTCCCAGCACAGGTGG - Intergenic
1106490461 13:30216719-30216741 CCTGTGCCTACCGATACAGAAGG + Intronic
1107559201 13:41545203-41545225 CCCTGGCATACCAGTACATGTGG - Intergenic
1110598523 13:77345110-77345132 CCTCTGTCTACCAGTACAGGAGG - Intergenic
1112173774 13:97000602-97000624 CCAGTGACAACCAGGACAGGCGG + Intergenic
1119423009 14:74518784-74518806 CCTGGGCCCACCAGTACAGCAGG - Intronic
1119445628 14:74661135-74661157 CCCGAGCCGACCACTTCAGGAGG + Intronic
1122071570 14:99208655-99208677 CCCGAGCCTGCCCGGACAGGAGG - Intronic
1122742810 14:103881729-103881751 CCCGAGCCTCCCAGAACAGCAGG - Intergenic
1124109158 15:26771856-26771878 CCCGGGTCTCCCAGTCCAGGAGG + Intronic
1127715420 15:61644742-61644764 CCAGTGCCTAGGAGTACAAGGGG - Intergenic
1129412690 15:75358732-75358754 CCCATGCATCCCAGTACAAGGGG + Exonic
1133223021 16:4327472-4327494 CCCGTGCCTTCCAGTAGGGAGGG + Intronic
1147286846 17:39409105-39409127 ACCCCACCTACCAGTACAGGTGG - Exonic
1148776282 17:50097232-50097254 CCCATGCCTAACACTTCAGGAGG - Intronic
1149734994 17:58985743-58985765 CTCCTGCCTACCAGTAAAGAAGG + Intronic
1152137597 17:78514009-78514031 CCAGTGCCTGCCAGTACTGTGGG + Intronic
1157466788 18:47954148-47954170 CCTGTGCCTACCAGTAACTGTGG + Intergenic
1157493082 18:48137235-48137257 CCTGCGCTTAACAGTACAGGTGG - Intronic
1161890227 19:7030645-7030667 CCCGTACTCACCAGAACAGGTGG - Exonic
1161891222 19:7040089-7040111 CCCGTACTCACCAGAACAGGTGG + Exonic
1161893307 19:7058550-7058572 CCCGTACTCACCAGAACAGGTGG + Exonic
937266134 2:120615700-120615722 GCCCTGCCTACCAGCAAAGGTGG + Intergenic
937377607 2:121348410-121348432 CCCGTCCCTGCCAGTGAAGGAGG + Intronic
938468074 2:131535860-131535882 CCCGTGCCTGCCCGTGCAGGGGG + Intergenic
1169201782 20:3714021-3714043 TCCCTGCCTACCTGTACTGGTGG + Intergenic
1175543991 20:59766303-59766325 CCCTTGCCTACTATTGCAGGAGG - Intronic
1179247447 21:39645955-39645977 CCTCTGCCTCCCAGCACAGGTGG + Intronic
1180985411 22:19901255-19901277 CCCGTGGGTGCCAGGACAGGAGG - Intronic
1185403111 22:50628445-50628467 CCCGAGTCTCCCAGTACCGGAGG - Intergenic
954700575 3:52448787-52448809 CCGGTGGCTTCCAGTACAGTGGG - Intergenic
954994951 3:54872562-54872584 CTCATGCCTTCCAGAACAGGGGG + Intronic
955173958 3:56594218-56594240 CACCTGCCTTCCAGTACAGAAGG + Intronic
957474562 3:80706449-80706471 CCAGTGCCTCCCAGGACATGCGG + Intergenic
978840676 4:113208426-113208448 CCCTTGCCTAACAGTATAGATGG + Intronic
988386779 5:30575303-30575325 CCTGGGCATACCAGGACAGGGGG - Intergenic
988852083 5:35190161-35190183 CCCCAGCAAACCAGTACAGGGGG + Intronic
991631971 5:68665447-68665469 GTCGGGCATACCAGTACAGGTGG - Intergenic
994730089 5:103481588-103481610 CTCCTGCCTGCCAGTGCAGGTGG + Intergenic
995506022 5:112861399-112861421 CCCCGGCCGACCAGGACAGGTGG + Exonic
1003424988 6:5993025-5993047 CCCTTCCCCACCAGTGCAGGAGG + Intergenic
1005674862 6:28143493-28143515 CCACTACTTACCAGTACAGGAGG - Intronic
1007180679 6:39927180-39927202 CCCTTGCTTACCAGGCCAGGTGG - Intronic
1012044046 6:94246512-94246534 CCTATGCCTACCATTACAGCTGG - Intergenic
1019275753 7:174652-174674 CCCTCGCCCAGCAGTACAGGGGG - Intergenic
1019654818 7:2185844-2185866 CCCCAGCCTACCTGTTCAGGAGG + Intronic
1020087494 7:5319075-5319097 CCAGCACCTCCCAGTACAGGGGG + Intronic
1020284158 7:6667464-6667486 CCCGTCCCTACCACTACAGAGGG - Intergenic
1024633390 7:51267372-51267394 CCCCTGCTCACCAGTGCAGGTGG - Intronic
1025206816 7:56998089-56998111 CCAGCACCTCCCAGTACAGGGGG - Intergenic
1025665124 7:63578838-63578860 CCAGCACCTCCCAGTACAGGGGG + Intergenic
1037312047 8:17566332-17566354 GCCGTTCCTATCAGAACAGGGGG - Exonic
1038684888 8:29707622-29707644 CCCCTGCCCAGCAGTACAGAGGG - Intergenic
1047659099 8:127013196-127013218 CCGGTGCCTACCTGTGCAGATGG + Intergenic
1052781008 9:32782632-32782654 CCCCTGCCTACCAGAGCGGGAGG + Intergenic
1058023773 9:100118011-100118033 CCTGTGCCTAGCAGTTCTGGAGG - Intronic
1186480166 X:9890646-9890668 CTCGTGCCAAACAGTGCAGGGGG - Intronic
1186480173 X:9890697-9890719 CTCGTGCCAAACAGTGCAGGGGG - Intronic
1186480193 X:9890851-9890873 CTCGTGCCAAACAGTGCAGGGGG - Intronic
1186480204 X:9890900-9890922 CTCGTGCCAAACAGTGCAGGGGG - Intronic
1187317220 X:18207064-18207086 CCCTGGCCTAGCAGTGCAGGGGG + Intronic
1201304221 Y:12536988-12537010 CTCGTGCCAAACAGTTCAGGAGG - Intergenic
1201304260 Y:12537192-12537214 CTCGTGCCAAACAGTGCAGGGGG - Intergenic
1201304271 Y:12537241-12537263 CTCGTGCCAAACAGTGCAGGTGG - Intergenic