ID: 910874656

View in Genome Browser
Species Human (GRCh38)
Location 1:91867270-91867292
Sequence TCCCCCGTGCCTACCAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910874656_910874657 -5 Left 910874656 1:91867270-91867292 CCTGTACTGGTAGGCACGGGGGA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 910874657 1:91867288-91867310 GGGGAAGCAGTACGCACAGATGG No data
910874656_910874658 2 Left 910874656 1:91867270-91867292 CCTGTACTGGTAGGCACGGGGGA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910874656 Original CRISPR TCCCCCGTGCCTACCAGTAC AGG (reversed) Intronic
901123122 1:6911077-6911099 TCCCCTGTGCCTACCACTCCTGG + Intronic
908836377 1:68232646-68232668 TACCCCTTGCCCACCAGTTCGGG + Intronic
910874656 1:91867270-91867292 TCCCCCGTGCCTACCAGTACAGG - Intronic
1067562649 10:47314661-47314683 TCCCCCTCACCTACCAGTTCTGG - Intergenic
1067816358 10:49480318-49480340 TCCCCTGTGCCCACCCCTACTGG + Intronic
1071526515 10:86362753-86362775 TCCCCGGTGCCTGCAAGGACAGG - Intronic
1076347141 10:129786986-129787008 ACCCCCGTGCCGTCCAGCACTGG + Intergenic
1077603160 11:3588488-3588510 TTCCCAGTGCCTACCAGGAATGG + Intergenic
1078863867 11:15278617-15278639 TCCCCAGTGGCTATCATTACAGG - Intergenic
1080613869 11:33929113-33929135 TCCCAAGTACCTACCACTACAGG - Intergenic
1083777356 11:64900729-64900751 TCCCGCCTGCCTTCCAGGACTGG - Intronic
1084081432 11:66828210-66828232 TCCCCCTTGGTTTCCAGTACTGG + Intronic
1084259051 11:67963030-67963052 TTCCCAGTGCCTACCAGGAATGG + Intergenic
1084813707 11:71632148-71632170 TTCCCAGTGCCTACCAGGAATGG - Intergenic
1088253005 11:107877945-107877967 TCCCCAGTACCTACAATTACAGG + Intronic
1090448931 11:126789141-126789163 TCCCCAGTGCCTAGCAGCCCTGG + Intronic
1094382271 12:29855770-29855792 TCCCCCATTCCTACCTGAACAGG - Intergenic
1096193441 12:49634315-49634337 TCCCCTGTGCCCTCCAGTTCTGG + Exonic
1106376202 13:29190585-29190607 TCACCTGTGCCTACCACCACAGG - Intronic
1119801450 14:77448793-77448815 AGCCCCATGCCTACCAGTTCAGG + Intronic
1120521425 14:85531390-85531412 TCCGCCGCGCTGACCAGTACGGG + Intronic
1120968878 14:90191267-90191289 GCCCCCGTGACTTCCAGTGCTGG + Intergenic
1122987918 14:105221135-105221157 TCCCCCATCCCTGCCAGGACAGG - Intronic
1124006353 15:25798334-25798356 TCCCCCACGCCTCCCAGCACTGG - Intronic
1125975560 15:43948372-43948394 TCCCCCATGCTTACAAGTAATGG - Intronic
1128371645 15:67044184-67044206 TCCCCCAAGCCTCCCAGAACAGG + Intergenic
1128650655 15:69410439-69410461 TGCCCAGTGCCTAGCAGTGCAGG - Intergenic
1133285126 16:4687126-4687148 TCACCTGTCCCTCCCAGTACTGG + Intronic
1133365820 16:5208831-5208853 TTCCCAGTGCCTACCAGGAATGG - Intergenic
1141488177 16:84354929-84354951 TCCTCCATGCCTAGCAGTAGGGG + Intergenic
1144213738 17:13036445-13036467 TCCCCAGAACCTACGAGTACAGG - Intergenic
1154165478 18:12011355-12011377 ACCCCTGTGCCCACCAGTGCTGG + Intronic
1155189373 18:23415872-23415894 TCTCCTGTGCCTGCCAGTATTGG - Intronic
1159776480 18:72608692-72608714 TCCCACGTGCCTAGGAGCACAGG + Intronic
1160709001 19:542197-542219 CTCCCCGTGCCTCCCAGGACAGG - Intergenic
1166965499 19:46527356-46527378 TCCCCCGTGGGAACCAGTGCAGG + Intronic
935046570 2:99489249-99489271 TCCCCGGTGCATCCCAGAACCGG - Intronic
935502144 2:103854827-103854849 GCCACCGTGCCCACCAGTACTGG + Intergenic
946502224 2:220261690-220261712 GATCCCATGCCTACCAGTACAGG + Intergenic
1172797023 20:37547276-37547298 CCACCCGTGCCTACCAGTCCGGG + Intergenic
1176936545 21:14874542-14874564 TGCCCTCTGCCTAGCAGTACTGG + Intergenic
1178431862 21:32524626-32524648 TCCCCCTTGCTGACCAGCACAGG - Intergenic
1181464555 22:23103876-23103898 TCCCCAGTGCCTACAAATGCTGG + Intronic
1183333089 22:37231792-37231814 TCCCCAGTGCCAACCAGGGCTGG - Intronic
952912597 3:38203743-38203765 ACCCCTGTGGCTACCAGCACTGG + Intronic
953826958 3:46261796-46261818 GCCTCAGTGCCTACCAGTGCAGG + Intronic
955714143 3:61810939-61810961 TCCCCCTTGCCTACCTGTGTTGG + Intronic
957073997 3:75587560-75587582 TTCCCAGTGCCTACCAGGAATGG + Intergenic
960666499 3:120114095-120114117 TCCCCAGTGCCTAGCACTGCAGG + Intergenic
961280087 3:125759177-125759199 TTCCCAGTGCCTACCAGGAATGG - Intergenic
961874316 3:130010402-130010424 TTCCCAGTGCCTACCAGGAATGG + Intergenic
962052093 3:131826911-131826933 TCCCAAGTGGCTAGCAGTACAGG - Intronic
964398325 3:156272111-156272133 ACCCCCGTGGCTACCACCACTGG + Intronic
964541751 3:157787257-157787279 TCTCCCCTGCCTACCATTATAGG + Intergenic
969736364 4:8993447-8993469 TTCCCAGTGCCTACCAGGAATGG - Intergenic
969795558 4:9525012-9525034 TTCCCAGTGCCTACCAGGAATGG - Intergenic
978437321 4:108699477-108699499 TCCCCCATGACTTCCAGAACAGG - Intergenic
983287719 4:165760617-165760639 TCCCCCATCCCTACCAGTCTTGG - Intergenic
987138941 5:14926235-14926257 GCCCCCTGGCTTACCAGTACCGG + Intergenic
988819075 5:34862890-34862912 TCCCCCAGGCCTCCCAGTTCAGG + Exonic
989139017 5:38183767-38183789 TCTCCAGTGCCTACTAGAACAGG - Intergenic
997206103 5:132051143-132051165 TCCCCCGGGCTGACCAGCACTGG + Intergenic
998515842 5:142753335-142753357 TCCTCCCTGCCTCCCAGGACAGG - Intergenic
1019433244 7:1009357-1009379 TCCCCGGCGCTTACCAGCACAGG - Intronic
1025145620 7:56499515-56499537 TCCCCAGTACCTAACACTACAGG - Intergenic
1029076070 7:97935692-97935714 TTCCCAGTGCCTACCAGGAATGG + Intergenic
1031991567 7:128202298-128202320 TTCCCCGGGCCTTGCAGTACTGG + Intergenic
1033171349 7:139087264-139087286 TCCTCCATGACTACCAGCACGGG - Intronic
1034338576 7:150338601-150338623 CCCCTGGTGCCTACCAGTGCTGG + Exonic
1034546605 7:151793688-151793710 TCCCCCGTGCCTCCCAGCAGAGG - Intronic
1036241442 8:7084695-7084717 TTCCCAGTGCCTACCAGGAATGG - Intergenic
1036260393 8:7235460-7235482 TTCCCAGTGCCTACCAGGAATGG + Intergenic
1036306222 8:7604062-7604084 TTCCCAGTGCCTACCAGGAATGG - Intergenic
1036312430 8:7694016-7694038 TTCCCAGTGCCTACCAGGAATGG + Intergenic
1036357067 8:8052047-8052069 TTCCCAGTGCCTACCAGGAATGG - Intergenic
1036580633 8:10071976-10071998 TCCCTCGTGGCTGCCCGTACGGG + Intronic
1036901505 8:12673215-12673237 TTCCCAGTGCCTACCAGGAAAGG + Intergenic
1039050197 8:33485469-33485491 TCCTTCGTGCCTACCAATGCAGG + Intronic
1040926690 8:52691798-52691820 TCCCATGGGTCTACCAGTACCGG + Intronic
1057705281 9:97391271-97391293 TCTCCTGTGCCTACCAATATTGG - Intergenic
1061636653 9:131914813-131914835 TCCCCAGTGCCACCCAGTTCAGG - Intronic
1187198239 X:17109129-17109151 TCCCACATCCCTACCAGAACTGG - Intronic
1188443893 X:30236820-30236842 TCCCCAGTGCGTTCCAGTTCTGG + Exonic