ID: 910874658

View in Genome Browser
Species Human (GRCh38)
Location 1:91867295-91867317
Sequence CAGTACGCACAGATGGTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910874652_910874658 5 Left 910874652 1:91867267-91867289 CCACCTGTACTGGTAGGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG 0: 1
1: 0
2: 0
3: 1
4: 51
910874656_910874658 2 Left 910874656 1:91867270-91867292 CCTGTACTGGTAGGCACGGGGGA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910874658 Original CRISPR CAGTACGCACAGATGGTACG AGG Intronic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
923406030 1:233661551-233661573 AAGGAGGCACAGATGGTAAGAGG - Intronic
1065035815 10:21637793-21637815 CACTACACACTGATGGTACTTGG - Intronic
1069583319 10:69579652-69579674 AAGTTCGCACAGATGGTGGGTGG - Intergenic
1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG + Intergenic
1074696636 10:116055721-116055743 CTGTCAGCACAGATGGTGCGGGG - Intergenic
1076622637 10:131802328-131802350 CAGTACCCACTGATGGCTCGAGG + Intergenic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1088790364 11:113220311-113220333 GAGAATGCACAGATGGTATGTGG - Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1096686882 12:53293903-53293925 CAGGACGGACGGATGGTACCTGG - Intergenic
1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG + Intergenic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1123150206 14:106174441-106174463 CACTACGCACAGAAGTTCCGGGG - Intergenic
1125743840 15:41985944-41985966 CAGCAGGCACAGGTGGTTCGCGG + Exonic
1137483257 16:48870110-48870132 AAATAGGCACAGATGGTAGGTGG + Intergenic
1139922590 16:70469311-70469333 CAGTACCCACCCATGGTAAGGGG - Exonic
1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG + Intergenic
1158425299 18:57334587-57334609 CAGCAAGCACAGAAGGTGCGGGG - Intergenic
1161732719 19:5971651-5971673 CAGTTCTCAAAGATGGTCCGGGG - Intronic
925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG + Intergenic
927439671 2:23104422-23104444 CAGTTTGAACTGATGGTACGTGG + Intergenic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
933301134 2:80542707-80542729 CAGCAAGCAGGGATGGTACGGGG + Intronic
946623915 2:221590852-221590874 CAGTAACCACATATGGTAAGTGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1172102697 20:32495069-32495091 CAGTACGCACAGCAGGTGCCTGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG + Exonic
1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG + Intronic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
960665683 3:120106707-120106729 CAGTACACTCAGAAGGTATGGGG + Intergenic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
969518718 4:7663534-7663556 CAGTGTACACAGAGGGTACGTGG - Intronic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
995153754 5:108884718-108884740 CAGAAAGCAAAGATAGTACGTGG - Intronic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1192298637 X:69877354-69877376 CAGTACGAAGAGATGGTAACAGG - Intronic
1195597893 X:106713612-106713634 CAGTAGCCACAGATGGCTCGTGG - Intronic