ID: 910877142

View in Genome Browser
Species Human (GRCh38)
Location 1:91887694-91887716
Sequence TCTCCAATTCTGCAATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910877142_910877145 -9 Left 910877142 1:91887694-91887716 CCACCCAATTGCAGAATTGGAGA 0: 1
1: 1
2: 0
3: 3
4: 124
Right 910877145 1:91887708-91887730 AATTGGAGATTCATTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910877142 Original CRISPR TCTCCAATTCTGCAATTGGG TGG (reversed) Intronic
902045700 1:13522589-13522611 TCTCTACTTCTGCCATTGGCTGG - Intergenic
902125323 1:14205062-14205084 TCTCCAATTCTTCATTCAGGAGG + Intergenic
905423343 1:37863178-37863200 TCTCCCATCCTGCAGTGGGGAGG + Intronic
907711087 1:56882179-56882201 TCTCCATCTCTACAATTTGGTGG + Intronic
908310032 1:62871779-62871801 TAATAAATTCTGCAATTGGGAGG + Intergenic
909167378 1:72246675-72246697 TCTACAATTCTGCAATTGGGAGG + Intronic
910877142 1:91887694-91887716 TCTCCAATTCTGCAATTGGGTGG - Intronic
913486037 1:119333566-119333588 TCTCCATTTGTGAAATTGGGAGG + Intergenic
915621626 1:157089631-157089653 TTTTCAATTCTGTAATTGAGTGG + Intergenic
916348219 1:163818737-163818759 GCTCCACTTCTGAAATTGTGTGG - Intergenic
920895445 1:210044097-210044119 TCTCCACTGCTGTAATTGGCTGG + Intronic
920989500 1:210923207-210923229 TCTCCAATTCTGCAATTATTAGG - Intronic
1063529837 10:6820554-6820576 CCTGCAATTCTGCAGATGGGTGG - Intergenic
1063693592 10:8311196-8311218 TCTCTAATTTTGGAATTTGGTGG + Intergenic
1065633855 10:27710571-27710593 TTGCCAATTCTGCAGTTGTGTGG - Intronic
1070252919 10:74788681-74788703 ACTCCAATTATGCAATTTAGTGG - Intergenic
1071553575 10:86585629-86585651 ACTGCAATTCTGCCACTGGGTGG - Intergenic
1075492990 10:122890158-122890180 ATTCCAATTCTGCTACTGGGTGG + Intergenic
1076124564 10:127963603-127963625 TCTCCAATCCTGGAGTTGTGGGG + Intronic
1076565527 10:131396279-131396301 TCCCTAGTTCTGCAATTGGTGGG - Intergenic
1079794061 11:24776797-24776819 TCTCCATTTCTGCACCTGGAAGG + Intronic
1080452966 11:32393845-32393867 TCTACAATTCTTCAATGGGTTGG + Intronic
1082973583 11:59050276-59050298 TCTCCAATTCGTCATCTGGGTGG - Intergenic
1082977981 11:59094088-59094110 TCTCCAATTCGTCATCTGGGTGG - Intergenic
1083143542 11:60740607-60740629 TCTCAAATTCTGCTCCTGGGAGG - Intronic
1084723093 11:70921546-70921568 TGCCGAATTCTGAAATTGGGAGG + Intronic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1090907836 11:131092789-131092811 TCTCCAATTCTCTATCTGGGAGG + Intergenic
1093546664 12:20356738-20356760 TTTCAAATTCTGAACTTGGGTGG + Intergenic
1100208534 12:92377258-92377280 TCTCCAATTCTTCATCTGTGAGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1109010705 13:56938678-56938700 TCGCCTATTATGCAATGGGGAGG - Intergenic
1109681331 13:65756659-65756681 TCTGCCATTCTGGATTTGGGAGG - Intergenic
1111561377 13:89953241-89953263 TCTTCAATTTTACAATTGAGTGG + Intergenic
1115670579 14:35607582-35607604 TCTACAAGTCAGCACTTGGGAGG - Intronic
1115738440 14:36361113-36361135 TCTACCTTTCTGCCATTGGGTGG + Intergenic
1116607231 14:47015836-47015858 TCTGTAATTCTGCATTTTGGGGG - Intronic
1116784158 14:49269070-49269092 TCTCCCATTCTGGAGTTTGGAGG - Intergenic
1117567406 14:57008965-57008987 TCTCATATTCTGCAAATGTGTGG - Intergenic
1120155627 14:81089856-81089878 TCTCAAAATCAGCAAATGGGAGG - Intronic
1122486007 14:102080493-102080515 TCTTCACTTCTGAAATTTGGTGG - Intergenic
1122847363 14:104507125-104507147 TCTGCAGCTCTGCAACTGGGGGG + Intronic
1126170694 15:45693051-45693073 TCTCCCATTCTGGGACTGGGGGG - Intergenic
1127546813 15:60000208-60000230 TCTTCAAATCTGCACTTTGGTGG - Intergenic
1130565494 15:84991302-84991324 TTTCCAATTTTTCAACTGGGCGG - Intronic
1135837129 16:25836540-25836562 TCTCCACTTCTGCTATTTAGGGG + Intronic
1137047339 16:35680144-35680166 TCTCGAATTCTACAATAAGGGGG - Intergenic
1138826000 16:60320837-60320859 TGTACAATTCTGCAAATGTGAGG - Intergenic
1141798821 16:86293294-86293316 TCTCCAAGTGTCCAATTCGGGGG - Intergenic
1145693671 17:26770687-26770709 TCTGCAATGCTGCCATTGTGAGG + Intergenic
1145789331 17:27615796-27615818 TCTCCCATTCTTCCACTGGGAGG - Intronic
1146198888 17:30838237-30838259 ACTCCAATTCTGCCATGGTGGGG - Intronic
1150726275 17:67653937-67653959 TCACCCATCCTGCCATTGGGAGG + Intronic
1153003413 18:476587-476609 TCTCCCTTTCTGCACTGGGGCGG - Intronic
1153789075 18:8561453-8561475 CCTCCAGTTCTGCCCTTGGGTGG - Intergenic
1156789705 18:40955977-40955999 TCTCCAATTCTGAAACCAGGGGG + Intergenic
1157926657 18:51774054-51774076 TCCCAAATTCTGCAATTAAGTGG + Intergenic
1158081617 18:53599193-53599215 TCTCCCATTCTGCATGTGGTTGG - Intergenic
1161986483 19:7657679-7657701 TCTACAGTTCCTCAATTGGGGGG + Intergenic
927606875 2:24492932-24492954 TCTCCTCTTCTGGAATTGGTTGG + Intronic
930957790 2:57224905-57224927 TCTCCATTGGTGCATTTGGGAGG + Intergenic
932425207 2:71629412-71629434 TGTCTGATTCTGCAATTGGTTGG + Intronic
936770476 2:115906968-115906990 CATCTACTTCTGCAATTGGGAGG + Intergenic
937318222 2:120945443-120945465 TCTCCTGTTCTGCAGGTGGGTGG + Intronic
939473751 2:142658972-142658994 TCTCCTCTTCTGCAGGTGGGAGG - Intergenic
944741236 2:202614667-202614689 TCTCCAAATGTGCAGTAGGGTGG - Intergenic
945593119 2:211758958-211758980 TCTCCACTTGTGCAATTAGCAGG + Intronic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
946335876 2:219036137-219036159 TCTCCCATTCCTCAATTGGCTGG + Intronic
946516495 2:220417219-220417241 TCTCCAATTCTGGAAGTGATCGG - Intergenic
947607467 2:231497244-231497266 TATGCAATCCTGCAATTGTGGGG + Intergenic
948000791 2:234565533-234565555 ACTCCAATTTTGCCATCGGGAGG + Intergenic
948136605 2:235641138-235641160 ACTCCATTTCTGTAATTGGCTGG - Intronic
1170746963 20:19108147-19108169 TTTCCAATTCTGAATCTGGGTGG - Intergenic
1172512757 20:35511988-35512010 TCTCCACTTGTGCAGCTGGGTGG + Exonic
1174411136 20:50337216-50337238 TCTCCATTTCTATAATTGTGTGG - Intergenic
1177577387 21:22976064-22976086 TCTACAATTCTGCAGTCTGGAGG + Intergenic
1178562352 21:33650661-33650683 TCTCCAATTCTGCAAGACTGGGG - Intronic
1178601295 21:33996950-33996972 TCCCCAACTCTGGGATTGGGAGG + Intergenic
1181784911 22:25220045-25220067 CCTCCACATCTGCAATTAGGGGG + Intronic
1183013895 22:34970271-34970293 ACCCCAACTCTTCAATTGGGGGG - Intergenic
1185039991 22:48498926-48498948 TCTCCACTTCTGCAGCTGGACGG + Intronic
951451157 3:22840121-22840143 TCTCCTCTCCTTCAATTGGGTGG - Intergenic
953325632 3:42010335-42010357 TCTCCAATGTTGCTTTTGGGGGG + Intergenic
953818522 3:46183450-46183472 GCTCCAATTCTTCCACTGGGTGG - Intronic
955097955 3:55818633-55818655 TCTCCACTTCTGCAAGATGGAGG + Intronic
955827645 3:62965231-62965253 TCTGCAGTTCTGAAATTAGGTGG + Intergenic
956406195 3:68931661-68931683 GCTCCAGTTCTCCACTTGGGCGG + Intronic
956451004 3:69374831-69374853 TCTACAATTCTTCATCTGGGTGG + Intronic
957888220 3:86318641-86318663 TCTCACAGTCTGCAACTGGGAGG - Intergenic
958619491 3:96538338-96538360 TCTCCTGTTCAGCAAGTGGGAGG - Intergenic
962851052 3:139308604-139308626 TCTTCAATTCAGCCATTGGTTGG - Intronic
963778818 3:149466286-149466308 CCTTCATTTCTGCAAGTGGGAGG + Intergenic
967302194 3:188025733-188025755 TTTCCAGTTCTTCACTTGGGTGG - Intergenic
969050078 4:4366520-4366542 ACTACAATTCTGGATTTGGGTGG - Intronic
969339903 4:6533637-6533659 TCTGCAATCCTGCATTTGGACGG - Intronic
971090417 4:23337202-23337224 TCTCAGTTTCTGCAATTTGGGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
975410489 4:74043169-74043191 ACTCAAATTCTGCATTTTGGAGG + Intergenic
978229347 4:106379535-106379557 TCTCCCATTCTGCCATTCTGTGG - Intergenic
979855345 4:125625302-125625324 TCTACAATTCTACAATTCAGTGG - Intergenic
981721591 4:147807187-147807209 TCTCCATTTCATGAATTGGGGGG - Intronic
983088356 4:163474322-163474344 AATTCTATTCTGCAATTGGGTGG - Intergenic
983976151 4:173936725-173936747 TTTCCAGTTCTGCATATGGGAGG - Intergenic
986601337 5:9476212-9476234 TCTACAATTGTGTAATTAGGTGG + Intronic
988094163 5:26581378-26581400 TCTCCAATTCTGTAAGTTGTTGG + Intergenic
993326454 5:86544316-86544338 TCTCGAAGTCAGCAATTGGAAGG + Intergenic
995364585 5:111343678-111343700 TCTGGGATTCTGAAATTGGGTGG + Intronic
998627412 5:143861476-143861498 TCTCCAATTCTGCAAATCTTGGG + Intergenic
1011777292 6:90745971-90745993 TTTCCATTTCTATAATTGGGTGG - Intergenic
1013632722 6:112000846-112000868 TCTCCAAGTCAGAAATAGGGAGG + Intergenic
1016168962 6:140984428-140984450 TATCCAATTCTGCAGTTGCTTGG + Intergenic
1017700809 6:157068469-157068491 TCTCCAGTTCTCCAATTGCTTGG - Intronic
1024435270 7:49345554-49345576 TCACCAATTTTGCCAGTGGGAGG - Intergenic
1024725542 7:52189678-52189700 TCTCCCATTCAGGAACTGGGAGG - Intergenic
1025098634 7:56116833-56116855 TATCCAAGTGTGCAATAGGGAGG + Intergenic
1029664972 7:101989224-101989246 TCTCCGGTTCTGCAGCTGGGTGG - Intronic
1031351603 7:120738742-120738764 GCACCAATTATGTAATTGGGAGG - Intronic
1032426636 7:131827854-131827876 TCCTAAATTCTGCAATAGGGAGG + Intergenic
1035348997 7:158230359-158230381 ACTCCAATACTGTAATTGTGGGG + Intronic
1037020587 8:13965600-13965622 CCTCTAATTCTGGAATTGGGAGG - Intergenic
1055385181 9:75753918-75753940 TTTCCAATTCTTCATTTGGCTGG - Intergenic
1055803419 9:80066359-80066381 TCTCCATTACTGCAATTAGATGG - Intergenic
1057480460 9:95441235-95441257 TCTCCACTTCTCCTTTTGGGAGG + Intergenic
1185519385 X:727664-727686 TCTGCCATTGTGCATTTGGGAGG + Intergenic
1191854445 X:65612102-65612124 TCCCCAATGCAACAATTGGGAGG + Intronic
1192028714 X:67485593-67485615 TCTCCATGTCTGCTATTAGGCGG + Intergenic
1193270964 X:79530270-79530292 ACTCCATCTCTGCCATTGGGAGG - Intergenic
1198377100 X:136051019-136051041 TCTCCAGTTTAGCAATTTGGAGG + Intergenic