ID: 910879319

View in Genome Browser
Species Human (GRCh38)
Location 1:91908120-91908142
Sequence GTTTCAAAGGGGCATTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910879311_910879319 18 Left 910879311 1:91908079-91908101 CCAAAAAAAAAAGTATTTATTTC 0: 1
1: 1
2: 17
3: 196
4: 1751
Right 910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 177
910879310_910879319 23 Left 910879310 1:91908074-91908096 CCTCTCCAAAAAAAAAAGTATTT 0: 1
1: 2
2: 32
3: 291
4: 2248
Right 910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910879319 Original CRISPR GTTTCAAAGGGGCATTGGGG TGG Intergenic
900241596 1:1619987-1620009 GCGTCACAGGGGCAGTGGGGTGG - Intronic
901352958 1:8614465-8614487 TTTTAAAAGGGGCTCTGGGGAGG + Intronic
905242821 1:36592110-36592132 GATTTAAAGGGGCATCGGTGAGG - Intergenic
908928893 1:69291828-69291850 CTTTCAAAGGGGCAAAGGGTTGG + Intergenic
910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG + Intergenic
912586656 1:110772599-110772621 CTTTATAAGGGGCATTGGGAAGG - Intergenic
914251434 1:145925020-145925042 GATCCAAAGGAGCATTGAGGAGG - Intergenic
917698505 1:177555470-177555492 CATTCAAAGGTGCAATGGGGAGG + Intergenic
920163533 1:204018522-204018544 TGTTCAAAGGGCCATTGGAGAGG - Intergenic
924501341 1:244641622-244641644 GTTTCATAGGGTTATTGAGGAGG - Intergenic
1064349904 10:14567299-14567321 TTTGCAAAGGGGCAGTGGGAAGG + Intronic
1073572384 10:104591546-104591568 ATTTGAAAGGGGGAATGGGGTGG + Intergenic
1074726496 10:116315645-116315667 TTTTCAAATGGGGATAGGGGAGG - Intergenic
1075945853 10:126432530-126432552 GTGTCAAAGGGGGAATGGAGAGG + Intronic
1075963876 10:126593541-126593563 CTGTCAAAGAGGCATGGGGGAGG + Intronic
1076418350 10:130308732-130308754 GTTTCAAAGGAGTTTTGGAGGGG + Intergenic
1082947142 11:58772506-58772528 TTTTCAAAGAGGCATGGGTGGGG + Intergenic
1085067694 11:73512534-73512556 CTTTCAAAGGGGGATAAGGGTGG + Intronic
1085541155 11:77271016-77271038 ATTTCAACGAGGCATAGGGGTGG + Intronic
1086134489 11:83432686-83432708 GTTTCAATGGGGGAGTGGGAGGG + Intergenic
1089188239 11:116635579-116635601 GCCTCCAAGGGGCATTGGGTTGG - Intergenic
1090425812 11:126606485-126606507 ATTTCACAGGGCCATGGGGGAGG + Intronic
1091300200 11:134502626-134502648 GTTTCAGGAGGACATTGGGGAGG - Intergenic
1091415869 12:283698-283720 TTTTAAAGGGGGGATTGGGGTGG - Exonic
1092927958 12:13289218-13289240 GATGCAGAGGGGCATTGGCGGGG + Intergenic
1092979935 12:13784558-13784580 ATTTCAAGGGGGCAGGGGGGTGG - Intronic
1094499954 12:31012326-31012348 GTTTCCAAGGGGCAGGGGAGAGG - Intergenic
1094861631 12:34473810-34473832 GTTTCAAATGGACATTTGGGAGG - Intergenic
1095080194 12:37990604-37990626 TTTGCAAAGGGACATTTGGGAGG + Intergenic
1096424245 12:51487693-51487715 GTATTACAGGGGCATTGGAGAGG + Intronic
1096888356 12:54741285-54741307 GTTTCAAAGGTTCCTTTGGGAGG + Intergenic
1097093639 12:56527755-56527777 GTATCAAGGGGGCATGGTGGGGG - Intronic
1097264181 12:57736438-57736460 GTTTCAATGCGGCTCTGGGGAGG + Intronic
1098174292 12:67774641-67774663 GTTTGAACGGGGGGTTGGGGAGG + Intergenic
1098387321 12:69933291-69933313 GTTTCAAAGGCCCAGTGTGGTGG - Intronic
1099337629 12:81384022-81384044 GTATCAAAGGGACATTAGGGAGG - Exonic
1109116570 13:58395687-58395709 GTAACTAACGGGCATTGGGGAGG - Intergenic
1109174728 13:59141283-59141305 CTTTCAAAGATGCAGTGGGGAGG - Intergenic
1110004160 13:70245227-70245249 GTTTGAAAGTGGTATTTGGGTGG - Intergenic
1113603304 13:111586567-111586589 GTGACTAAGGGGCCTTGGGGAGG + Intergenic
1114056962 14:18978479-18978501 GTTCCAAAGGGTCAGAGGGGTGG + Intronic
1114105584 14:19423267-19423289 GTTCCAAAGGGTCAGAGGGGTGG - Intronic
1115388994 14:32832582-32832604 TTTTCTAAGGGTAATTGGGGAGG - Exonic
1115978942 14:39028717-39028739 GTTAAAAAGGTGTATTGGGGAGG - Intergenic
1116888922 14:50248880-50248902 CTTTGAAAGAGGCATTGAGGAGG + Intronic
1117889126 14:60399122-60399144 GATCCAAAGGAGCATTGAGGAGG + Intronic
1118865788 14:69702520-69702542 GTTTCAAGAGGGCAAAGGGGAGG + Intronic
1119083023 14:71714528-71714550 GTTTTATTGGGGCAGTGGGGAGG + Intronic
1120994564 14:90406914-90406936 GTTTCAAAGGGGGCTGGAGGGGG + Exonic
1121389658 14:93563171-93563193 GTTTCAAAGGGGGAGTAGGTGGG + Intronic
1122730784 14:103795992-103796014 TTTTAAAATGGGCAATGGGGTGG + Intronic
1124009985 15:25830425-25830447 GTTGCAAAGGGGCAGTGTGGTGG - Intronic
1128343566 15:66839728-66839750 GTTTCCTATGGGCACTGGGGAGG - Intergenic
1129383427 15:75182478-75182500 GTTTCAAACAGGAATGGGGGTGG + Intergenic
1131145288 15:90007205-90007227 GGGTCAAAAGGGCTTTGGGGAGG + Intronic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1131446569 15:92502990-92503012 GTTTCTAAGGGGCAAAGGGATGG + Intergenic
1131879516 15:96847682-96847704 GTTTGAAGCTGGCATTGGGGAGG - Intergenic
1132045092 15:98556976-98556998 GATTCAAAGTGGCTTTTGGGTGG + Intergenic
1132394194 15:101460086-101460108 GGTTCATAGGGGCATAGTGGTGG - Intronic
1134197233 16:12168596-12168618 GTAGCACAGGGGCATTGGCGTGG + Intronic
1135723137 16:24833930-24833952 GATTCAAAGAGGCATTGATGAGG + Intergenic
1136742149 16:32544868-32544890 TCTTCAAAGGGACATTTGGGAGG + Intergenic
1138443260 16:57047523-57047545 GCTGCAAAGGGGCAATGGGCAGG - Exonic
1138599662 16:58047038-58047060 GTTTCCAAGGGCCATCGGGAAGG - Intergenic
1141717294 16:85734329-85734351 GTCTCACAGAGGCATTGGTGAGG + Intronic
1203027451 16_KI270728v1_random:530365-530387 TCTTCAAAGGGACATTTGGGAGG - Intergenic
1203044270 16_KI270728v1_random:804066-804088 TCTTCAAAGGGACATTTGGGAGG + Intergenic
1144710478 17:17398532-17398554 GTGTCAAGTGGGCTTTGGGGAGG + Intergenic
1144855053 17:18262927-18262949 TTTTCAGAGGGGCCCTGGGGAGG + Intronic
1145284839 17:21497694-21497716 GTGTCACAGGAGCATTGAGGAGG + Intergenic
1147150482 17:38511004-38511026 GTTCCAAAGGGGCTCTAGGGAGG - Exonic
1147582784 17:41636492-41636514 GTAGCAAAGGGGCCTGGGGGGGG - Intergenic
1147767125 17:42844726-42844748 GATACAGAGGGGCAGTGGGGAGG - Exonic
1147897208 17:43758527-43758549 GTCTCAAAGGGGTGGTGGGGAGG + Exonic
1150842469 17:68621718-68621740 TTTTCAAAGAGAGATTGGGGGGG + Intergenic
1151214739 17:72569738-72569760 GTTTCACAGTGGCAGAGGGGAGG - Intergenic
1154087370 18:11320513-11320535 GTTTCAAAGGGTGAATGGGATGG - Intergenic
1156568199 18:38220589-38220611 GGATCACAGGGGCATTGGGCTGG - Intergenic
1159395151 18:67846648-67846670 CTTGCAAAGTGGCATGGGGGAGG - Intergenic
1160877561 19:1304299-1304321 GGTTCATCGGGGCAGTGGGGTGG - Intergenic
1162219592 19:9164844-9164866 ATTTGAAAGGGGATTTGGGGAGG + Intergenic
1162752407 19:12836845-12836867 GTTTCAAAAGGCCTTTGGAGGGG - Intronic
1165388432 19:35525123-35525145 AATTAAAAGGGGCTTTGGGGAGG - Intronic
1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG + Intronic
928306265 2:30172634-30172656 TTTGCAAATGGGCATTGGGGAGG - Intergenic
928550820 2:32368652-32368674 GTTTCAAAAGGGGACAGGGGCGG - Intronic
931862911 2:66375655-66375677 GTTTTGTAGGGGCAATGGGGTGG + Intergenic
932274432 2:70441482-70441504 GTATGCAAGGGGCCTTGGGGTGG + Intergenic
932455884 2:71849802-71849824 GTTTCAGAAGGCCATGGGGGTGG - Intergenic
935187123 2:100744592-100744614 GTTTCAGAGGGGCATGGGTCTGG - Intergenic
937967569 2:127525826-127525848 GAATCCAAGGGGCGTTGGGGCGG - Intronic
943958672 2:194229851-194229873 GAAGCAAAGGGGCATTGGGGAGG + Intergenic
946322490 2:218961907-218961929 AATTAAAAGGGGCAGTGGGGAGG - Exonic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
1173080324 20:39861190-39861212 ATCTCATAGGGGCATTTGGGAGG - Intergenic
1173955050 20:47025254-47025276 GTTACAAAGTGGCATTGCTGTGG + Intronic
1175126657 20:56757315-56757337 GCATCAATGGGGCATTTGGGAGG + Intergenic
1175772169 20:61630744-61630766 GTTTCAAATGGGTATCAGGGAGG - Intronic
1180475449 22:15701091-15701113 GTTCCAAAGGGTCAGAGGGGTGG + Intronic
1181942857 22:26492234-26492256 GGCTCAGAGGGGCATTGGCGTGG - Exonic
1184207768 22:43015632-43015654 GTTTAAACGGGGGGTTGGGGGGG + Intergenic
1184422523 22:44390287-44390309 GTGCCAAAGGAGCATTGGGATGG + Intergenic
1184489903 22:44802508-44802530 GTTTCAAAGGGACAGTGCGTGGG - Intronic
1184802284 22:46768791-46768813 GTTTGAAAGTGGCATGGTGGTGG + Intronic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
957865816 3:86021322-86021344 GTTTGAAAGGGGAATTGAAGTGG - Intronic
961110747 3:124281152-124281174 ATTTCAAAGGGGCCATGGGATGG - Intronic
961401660 3:126650657-126650679 GTTTCAAAGGTGATTTAGGGAGG - Intronic
962158410 3:132973699-132973721 ATTTCTAAGGGGCATAAGGGTGG - Intergenic
964497172 3:157303780-157303802 GTTTCTAAGTGGCAATGGTGAGG - Intronic
966179866 3:177178461-177178483 GTTACAAAGTGGCATAGGGATGG - Intronic
968289047 3:197524896-197524918 TTTTCAAAGGGCCACTGGGGAGG - Intronic
968902027 4:3436379-3436401 GCTTCCAAGGGGCGCTGGGGAGG + Intronic
968907637 4:3462035-3462057 GGATCACAGGGGCAGTGGGGAGG + Intergenic
969540175 4:7783855-7783877 GTGTGAAAGGGTCTTTGGGGGGG + Intronic
970385784 4:15555177-15555199 GCATCAAAGGGGCATTGTTGGGG - Exonic
972136668 4:35902112-35902134 GACTCAAAGGGGCTTTGGGCTGG - Intergenic
972303171 4:37805468-37805490 GTTTCAAAGGGAATTTGGTGGGG + Intergenic
977210535 4:94212873-94212895 GATTTAGAGGGGCATTAGGGAGG - Intronic
978318052 4:107462230-107462252 GTCTCCATGGGGCATGGGGGAGG + Intergenic
979387531 4:120087000-120087022 GTTTGAAAGTGGTATTGGGCTGG + Intergenic
983926082 4:173403749-173403771 GTCTCTAAGGGGCATTGGACTGG + Intronic
985558481 5:569674-569696 GTCTCTCAGGGGCATCGGGGAGG + Intergenic
987496695 5:18653750-18653772 TTTTCAAAGAGGCACTGGAGAGG - Intergenic
988484100 5:31654138-31654160 GTTTCTAATGTGCATTGGCGTGG - Intronic
989955911 5:50359668-50359690 TTTTCTAAGGGGCAATGTGGTGG - Intergenic
990358731 5:54996751-54996773 GTTTCAGAGGGGCAGTGAGCTGG - Intronic
990769400 5:59225801-59225823 GTTTCAATTGGGTTTTGGGGGGG - Intronic
993630557 5:90281233-90281255 GTTATAAAGGGGCAGTGGGGCGG + Intergenic
993874336 5:93288790-93288812 GTTTCATAAGATCATTGGGGTGG - Intergenic
996622422 5:125523826-125523848 ATTTCTAAGGGGTATTTGGGAGG + Intergenic
999497788 5:152117266-152117288 CTTTCAGAGGGACATTTGGGAGG + Intergenic
999600255 5:153254601-153254623 GTTGCACAGGTGCATTGGTGTGG + Intergenic
1000678703 5:164156689-164156711 GTTTCTAAGAGGCATTTGAGAGG + Intergenic
1003320722 6:5048828-5048850 GTTTGAATGGGGCAATGGGAAGG + Intergenic
1003839682 6:10107021-10107043 ATATCAAACGGGGATTGGGGCGG + Intronic
1004265438 6:14144984-14145006 TTTTGAATGGGGCACTGGGGTGG - Intergenic
1004430865 6:15541767-15541789 GTTTTAATGGGGCATAAGGGTGG + Intronic
1005054028 6:21712760-21712782 GATTCAAAGTGGCCTTGGGCAGG - Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1008547283 6:52594371-52594393 CTCTCCAAGGGGCATGGGGGAGG + Intergenic
1010022630 6:71178631-71178653 GTTTCAACGTGACATTGGGAAGG - Intergenic
1011237480 6:85233330-85233352 ATTTGAAAGGGGCATTGGAGAGG + Intergenic
1012542024 6:100372394-100372416 CTTTCAAAAGGGGATTGGGCAGG + Intergenic
1013740612 6:113279627-113279649 ATGCCAAAGGGGCATGGGGGAGG + Intergenic
1015895055 6:138008920-138008942 GTATCAAGGGAGCATGGGGGAGG + Intergenic
1016782988 6:147980377-147980399 CTTAGAAAGGGGCATTGTGGAGG + Intergenic
1018686801 6:166309565-166309587 GTTTCAGAGCTGTATTGGGGTGG - Intergenic
1019378228 7:707628-707650 GTTACAAGAGGTCATTGGGGTGG + Intronic
1021653616 7:22854212-22854234 GTTTAAAAGGGGCCTGGGCGGGG - Intergenic
1022307184 7:29157809-29157831 GTTTCAAAGAGGCACTTAGGAGG + Intronic
1023767878 7:43528948-43528970 ATTTTTATGGGGCATTGGGGAGG + Intronic
1025090456 7:56058916-56058938 GTTTACAAGGGGCAAGGGGGAGG - Intronic
1025771812 7:64515367-64515389 GCTTGAAAGGGGCATTGTGTAGG - Intergenic
1027159009 7:75788800-75788822 GTTTCAAGGGGGCGTTCTGGGGG + Intronic
1030889543 7:114982444-114982466 GTTTGAGAGGGCCACTGGGGAGG + Intronic
1031591337 7:123595788-123595810 CTTTCAAGGGGGCTTTGGGTGGG - Intronic
1032165918 7:129544585-129544607 TTTACAAAGAGGCTTTGGGGTGG - Intergenic
1032872754 7:136003652-136003674 GTTTCAAAGGGGCAGTGTTGTGG + Intergenic
1033622833 7:143077596-143077618 GTTTCAAGTGGTCCTTGGGGAGG + Intergenic
1034333420 7:150304024-150304046 GTTTTAGAGGGGCATGGAGGTGG - Intronic
1034664621 7:152805865-152805887 GTTTTAGAGGGGCATGGAGGTGG + Intronic
1037652018 8:20847557-20847579 TTTTAAAAGGGGCATTGGTCTGG - Intergenic
1038269037 8:26060445-26060467 GTCCCAAAGGAGCATTGGGAGGG + Intergenic
1039581251 8:38668477-38668499 CTTTCCGAGGGGCCTTGGGGGGG - Intergenic
1039956206 8:42208878-42208900 GTAGAAAAGGGGCACTGGGGTGG + Intergenic
1042196782 8:66237908-66237930 GTTCCAAGGAGGCACTGGGGTGG + Intergenic
1043152378 8:76733925-76733947 GTTTCAAAGGGGCATGCATGAGG - Intronic
1044280927 8:90355100-90355122 GTTTCACAGGGAGATTGGGAAGG + Intergenic
1045505530 8:102775653-102775675 TTTCCATAGGGGCATTGAGGGGG + Intergenic
1045746079 8:105423834-105423856 GTTTCAGAGTGGGATTGGCGTGG + Intronic
1048561082 8:135538191-135538213 TTTCCAAAGGGGCTTTTGGGTGG + Intronic
1052151259 9:25118942-25118964 GTTACAAAGGTGCATTGCTGTGG - Intergenic
1055762909 9:79628660-79628682 GTTTCCAAGGGGCACTCTGGAGG - Intronic
1060201227 9:121652585-121652607 CCTTCAAAGGGGCTCTGGGGAGG + Intronic
1060570547 9:124635175-124635197 GTTTCCAAGGGTTAATGGGGAGG - Intronic
1061083232 9:128384737-128384759 GTCTCATAGGGTCATTGTGGGGG - Intronic
1061208924 9:129179487-129179509 GTTTCAAAGGTGCCTGGGGTGGG + Intergenic
1061543692 9:131291363-131291385 GTTCCAAAAGGGCATTGGGTTGG + Intronic
1203793846 EBV:165734-165756 GTTTTAGTGTGGCATTGGGGGGG + Intergenic
1190247629 X:48700886-48700908 GTGTCACAGGGACATTGGGCAGG + Intronic
1194080869 X:89464150-89464172 GTTTCAGAAGGGTAGTGGGGAGG - Intergenic
1195370638 X:104168790-104168812 TTTTCAATGGGGCAGTGAGGAGG + Intronic
1197119620 X:122875009-122875031 CTTTAAAAAGGACATTGGGGAGG - Intergenic
1197780408 X:130153583-130153605 TTGGCAATGGGGCATTGGGGAGG + Intronic
1199893344 X:152109802-152109824 GTTGCAGAGGAGCATTGGAGTGG + Intergenic
1200433544 Y:3120354-3120376 GTTTCAGAAGGGTAGTGGGGAGG - Intergenic