ID: 910880665

View in Genome Browser
Species Human (GRCh38)
Location 1:91919791-91919813
Sequence CTGAGGAAGGGAAAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910880665_910880672 7 Left 910880665 1:91919791-91919813 CCAACCACCTTTCCCTTCCTCAG No data
Right 910880672 1:91919821-91919843 AGAAAAACAAAAAACCTAGCAGG No data
910880665_910880673 8 Left 910880665 1:91919791-91919813 CCAACCACCTTTCCCTTCCTCAG No data
Right 910880673 1:91919822-91919844 GAAAAACAAAAAACCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910880665 Original CRISPR CTGAGGAAGGGAAAGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr