ID: 910885493 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:91959244-91959266 |
| Sequence | TTGGTCTGTAGTGATTGGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 140 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 127} |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910885493 | Original CRISPR | TTGGTCTGTAGTGATTGGAG TGG | Intronic | ||