ID: 910891731

View in Genome Browser
Species Human (GRCh38)
Location 1:92026423-92026445
Sequence CCCATCGTCTGGGATGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 6, 1: 2, 2: 4, 3: 25, 4: 705}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910891731_910891742 14 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891742 1:92026460-92026482 CGCTCCTCACTTCCCAGATGGGG 0: 516
1: 2852
2: 4749
3: 9803
4: 5601
910891731_910891743 17 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891743 1:92026463-92026485 TCCTCACTTCCCAGATGGGGTGG 0: 697
1: 4115
2: 10358
3: 4229
4: 3475
910891731_910891747 20 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891747 1:92026466-92026488 TCACTTCCCAGATGGGGTGGGGG 0: 143
1: 1502
2: 3062
3: 3898
4: 2022
910891731_910891746 19 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891731_910891749 25 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891749 1:92026471-92026493 TCCCAGATGGGGTGGGGGCCGGG No data
910891731_910891741 13 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891741 1:92026459-92026481 ACGCTCCTCACTTCCCAGATGGG 0: 462
1: 2987
2: 5658
3: 4727
4: 7843
910891731_910891745 18 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891745 1:92026464-92026486 CCTCACTTCCCAGATGGGGTGGG No data
910891731_910891740 12 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891740 1:92026458-92026480 GACGCTCCTCACTTCCCAGATGG 0: 2075
1: 3551
2: 4573
3: 7634
4: 4758
910891731_910891748 24 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891748 1:92026470-92026492 TTCCCAGATGGGGTGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910891731 Original CRISPR CCCATCGTCTGGGATGTGAG GGG (reversed) Intergenic
900390805 1:2433018-2433040 CCCAACCTCAGGGATGGGAGGGG - Intronic
901221696 1:7587129-7587151 CACCTGGTCTGGGATGGGAGTGG - Intronic
901341484 1:8501518-8501540 CCCCCCGTCCGGGAGGTGAGGGG + Intronic
901869328 1:12128303-12128325 CCCCAGGTCTGGGATGTGGGAGG - Intronic
902931017 1:19731587-19731609 CCCATCATCTGTGATGGCAGAGG + Intronic
903148266 1:21388335-21388357 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
903426496 1:23257706-23257728 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
903485933 1:23689157-23689179 CCCCCCGTCCGGGAGGTGAGGGG + Intergenic
903526154 1:23993990-23994012 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
903634142 1:24799947-24799969 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
903634271 1:24800245-24800267 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
903748608 1:25604351-25604373 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
903923743 1:26818373-26818395 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
904077519 1:27853322-27853344 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
904795163 1:33052290-33052312 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
904831569 1:33309357-33309379 CCCCCCGTCTGGGAGGTGGGGGG - Intronic
905315843 1:37081149-37081171 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
906486997 1:46241451-46241473 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
906487070 1:46241627-46241649 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
906956878 1:50381877-50381899 CGCTCCGTCTGGGAGGTGAGGGG + Intergenic
907382383 1:54101987-54102009 CCAATGGTCTGGGATGTGGCAGG + Intronic
907453536 1:54562001-54562023 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
907453611 1:54562179-54562201 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
910343979 1:86216365-86216387 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
910891731 1:92026423-92026445 CCCATCGTCTGGGATGTGAGGGG - Intergenic
912298258 1:108489389-108489411 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
912298308 1:108489516-108489538 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
912789996 1:112640500-112640522 CCCCCCGTCCGGGAGGTGAGGGG + Intronic
912844997 1:113069765-113069787 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
912845071 1:113069942-113069964 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
913078452 1:115360480-115360502 CGCCCCGTCTGGGAAGTGAGGGG - Intergenic
914775073 1:150728716-150728738 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
914908988 1:151769376-151769398 CGCCTCGTCTGGGAAGTGAGGGG - Intronic
914965737 1:152256175-152256197 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
915410928 1:155700772-155700794 CGCGCCGTCTGGGAGGTGAGGGG + Intronic
915992600 1:160532137-160532159 CACCCCATCTGGGATGTGAGGGG + Intergenic
916114801 1:161477492-161477514 CCCATCCTCTGGGAGATAAGTGG - Intergenic
916498326 1:165365222-165365244 CCCCTCATCTGCGAGGTGAGAGG - Intergenic
917375889 1:174349820-174349842 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
917848269 1:179040449-179040471 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
918221382 1:182439847-182439869 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
918228571 1:182509402-182509424 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
918255199 1:182741586-182741608 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
919520796 1:198584297-198584319 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
920795098 1:209129607-209129629 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
921142326 1:212320535-212320557 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
923268129 1:232332379-232332401 CCCCCCGTCCGGGAGGTGAGAGG + Intergenic
923901114 1:238327208-238327230 CGCCCCGTCTGGGAAGTGAGGGG - Intergenic
924382251 1:243475369-243475391 CCCATGGCCTGTGGTGTGAGGGG + Intronic
1064108304 10:12519329-12519351 CCCCCCGTCCGGGAGGTGAGGGG - Intronic
1065012150 10:21430322-21430344 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1065335979 10:24656418-24656440 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1065336051 10:24656595-24656617 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1065594330 10:27296502-27296524 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1065756350 10:28934644-28934666 CACCCCGTCTGGGAAGTGAGGGG + Intergenic
1067086619 10:43243555-43243577 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1067100314 10:43329751-43329773 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1068648256 10:59493172-59493194 CCCATCGTCAGGCCTCTGAGAGG - Intergenic
1069445428 10:68469139-68469161 CCCAAAGTGTGGTATGTGAGGGG - Intronic
1069741249 10:70687598-70687620 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1070317845 10:75333065-75333087 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1070840151 10:79480317-79480339 CTCATAGTTTGGGATTTGAGTGG - Intergenic
1071616669 10:87081223-87081245 CGCCTCTTCTGGGAGGTGAGGGG + Intronic
1072013279 10:91323078-91323100 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1072013535 10:91323827-91323849 CCCATCGTCTGGGATGCGAGGGG - Intergenic
1072116703 10:92375409-92375431 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1072116775 10:92375585-92375607 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1072149767 10:92674875-92674897 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1072149840 10:92675050-92675072 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1072648574 10:97276404-97276426 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1072949484 10:99838516-99838538 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1072980324 10:100093343-100093365 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1073386272 10:103129376-103129398 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1075050779 10:119181895-119181917 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
1075474202 10:122719252-122719274 CCCATCCTCTGGATGGTGAGAGG + Intergenic
1075978361 10:126716417-126716439 ACCATCCTCTTGGATGTGAAGGG - Intergenic
1076204788 10:128588468-128588490 CCCATCTCCTGGGCTGTGAGTGG + Intergenic
1076236935 10:128870909-128870931 CCCAGGGTCTGGGATGAGTGTGG - Intergenic
1077397632 11:2332744-2332766 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1077668476 11:4137359-4137381 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1080098146 11:28430626-28430648 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1080098194 11:28430753-28430775 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1080538357 11:33243697-33243719 CGCCCCGTCTGGGATGTGAGGGG + Intergenic
1081288887 11:41304425-41304447 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1081956325 11:47097177-47097199 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1081956399 11:47097353-47097375 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1083154774 11:60815683-60815705 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1083382514 11:62279232-62279254 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1083645892 11:64171937-64171959 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1083645967 11:64172113-64172135 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1083832172 11:65239707-65239729 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1084529175 11:69717046-69717068 CCAAGCGGCTGGGATGTGGGGGG + Intergenic
1084645779 11:70456919-70456941 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1084645791 11:70456956-70456978 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1084645850 11:70457144-70457166 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1084645864 11:70457181-70457203 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1084924692 11:72502454-72502476 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1085111931 11:73897066-73897088 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1085116649 11:73936724-73936746 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1085359859 11:75877439-75877461 CCCCCCGTCCGGGAGGTGAGGGG - Intronic
1085513188 11:77098463-77098485 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1085513262 11:77098639-77098661 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1085563322 11:77490533-77490555 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1086454582 11:86948498-86948520 TCCATTGTCTGGAATGTGAAAGG + Exonic
1086881753 11:92158314-92158336 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1087057198 11:93947030-93947052 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1090686618 11:129129078-129129100 CGCCCCGTCTGGGATGTGAAGGG + Intronic
1090790967 11:130091454-130091476 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1091022514 11:132113598-132113620 ACCACTGGCTGGGATGTGAGAGG + Intronic
1091405609 12:207370-207392 CCCATTATCCGGGTTGTGAGTGG - Intronic
1091762320 12:3095589-3095611 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1092331385 12:7590118-7590140 CCCCTCGTCTGGGAGGTGAGGGG - Intergenic
1092436602 12:8452222-8452244 CCCACTGTCTGGGAAGTGAGGGG - Intergenic
1094087402 12:26608649-26608671 CCCACAGTCTGTGAAGTGAGGGG + Intronic
1095068632 12:37814652-37814674 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1095439628 12:42228048-42228070 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1095452828 12:42350190-42350212 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1096022155 12:48332829-48332851 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1096427124 12:51513418-51513440 CTCTTCGTCTGGGATGTGATTGG + Exonic
1096441035 12:51644693-51644715 CCCATCGTCTGGGATGTGAGGGG + Intronic
1096557013 12:52409840-52409862 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1097028419 12:56075648-56075670 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1097626771 12:62010722-62010744 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1097626785 12:62010759-62010781 CCCCCCGTCTGGGAGGTGAGGGG + Intronic
1097626853 12:62010954-62010976 CCCTTCGTCTGGGAGGTGGGGGG + Intronic
1098019077 12:66135033-66135055 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1098023099 12:66174988-66175010 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1098375213 12:69807404-69807426 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1099257085 12:80327636-80327658 CCAATCTGCTTGGATGTGAGGGG + Intronic
1100577570 12:95907540-95907562 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1100582201 12:95947840-95947862 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1100995019 12:100294343-100294365 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102089474 12:110173368-110173390 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1102174649 12:110867084-110867106 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102174753 12:110867311-110867333 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102174905 12:110867663-110867685 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102293865 12:111723104-111723126 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102293942 12:111723280-111723302 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1102578546 12:113872422-113872444 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1102887872 12:116535079-116535101 GCGATCCTCTGGGATGTCAGAGG + Intergenic
1103350079 12:120278101-120278123 CCCATCGTCTGGGATGTGAGGGG - Intergenic
1103350119 12:120278214-120278236 CCCTTCATCTGGGAGGTGGGGGG - Intergenic
1103350148 12:120278290-120278312 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1103457103 12:121076275-121076297 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1103967972 12:124652247-124652269 CCCCAGGTCTGGGATGGGAGAGG - Intergenic
1104712538 12:130996618-130996640 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1105367872 13:19779584-19779606 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1105692881 13:22859286-22859308 CGCCCCGTCTGGGATGTGAGGGG - Intergenic
1106747638 13:32721391-32721413 CGCTCCGTCTGGGAAGTGAGGGG - Intronic
1106918700 13:34540918-34540940 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1106918823 13:34541193-34541215 CGCCCCGTCTGGGACGTGAGGGG + Intergenic
1108351519 13:49593403-49593425 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1108351618 13:49593628-49593650 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1108610620 13:52080296-52080318 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1108685898 13:52818240-52818262 CGCCTCGTCTGGGAGGTGGGGGG + Intergenic
1108893536 13:55294405-55294427 TCCATTGTCTGGGATATTAGGGG - Intergenic
1110269500 13:73575206-73575228 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1110626578 13:77661121-77661143 CTCACAGTCTGGGAAGTGAGGGG - Intergenic
1111123969 13:83889190-83889212 CCCATATTCTGGGCTGGGAGCGG + Intergenic
1111584520 13:90267936-90267958 CCCATCGTGTGCCCTGTGAGGGG - Intergenic
1112056019 13:95690878-95690900 CGCCCCGTCTGGGAAGTGAGGGG - Intronic
1112056115 13:95691104-95691126 CGCTCCGTCTGGGAAGTGAGGGG - Intronic
1112420314 13:99242417-99242439 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1112420392 13:99242593-99242615 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1113194113 13:107783092-107783114 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1113457335 13:110458048-110458070 CCCATGTTCTGGGAGGGGAGAGG - Intronic
1114500740 14:23166444-23166466 CTCATCGTCTGGATTGTGACGGG - Exonic
1115271650 14:31560079-31560101 CACCCCGTCTGGGAAGTGAGGGG - Intronic
1115547516 14:34476355-34476377 CGCCCCGTCTGGGAAGTGAGGGG + Intergenic
1116191776 14:41674162-41674184 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1116480561 14:45389671-45389693 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1116502103 14:45635086-45635108 CGCCCCGTCTGGGAAGTGAGGGG + Intergenic
1116502115 14:45635123-45635145 CACCCCGTCTGGGAAGTGAGGGG + Intergenic
1116502205 14:45635420-45635442 CGCCCCGTCTGGGAAGTGAGGGG + Intergenic
1118428436 14:65692318-65692340 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1119160423 14:72447664-72447686 CCCATCATCTTGACTGTGAGGGG - Intronic
1119711023 14:76822126-76822148 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1122771914 14:104101383-104101405 CCCACTGTCTGGGAAGTGAGGGG + Intronic
1122963579 14:105111499-105111521 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1122963732 14:105111852-105111874 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1124245966 15:28070567-28070589 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1125031708 15:35081764-35081786 CGCCCCATCTGGGATGTGAGGGG + Intergenic
1125079266 15:35656266-35656288 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1125079342 15:35656443-35656465 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1125079415 15:35656619-35656641 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1125659350 15:41382908-41382930 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1125659399 15:41383035-41383057 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1126503849 15:49380154-49380176 CCCATGGCCTGGGGTGTCAGTGG - Intronic
1126798106 15:52276881-52276903 CCCAGCACCTGGCATGTGAGCGG - Intronic
1127073100 15:55303336-55303358 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1127073147 15:55303462-55303484 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1127782827 15:62332164-62332186 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1128489599 15:68134324-68134346 CGCCTCGTCTGGGAGATGAGGGG - Intronic
1128970312 15:72101144-72101166 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1128970554 15:72101718-72101740 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1129054053 15:72807043-72807065 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1129054101 15:72807169-72807191 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
1129313860 15:74729224-74729246 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1129869811 15:78933056-78933078 CCCAGAGTCTGGGGTGTCAGGGG - Intronic
1130340592 15:82997792-82997814 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1130340646 15:82997922-82997944 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1130893295 15:88151274-88151296 CCCAGAGTCTGGTCTGTGAGAGG - Intronic
1131043755 15:89296768-89296790 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1131127351 15:89868242-89868264 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1131127424 15:89868418-89868440 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1131127500 15:89868594-89868616 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1131127551 15:89868721-89868743 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1133324790 16:4936283-4936305 CCCACCCTCTGGGTTCTGAGCGG - Intronic
1133833995 16:9350664-9350686 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1136160667 16:28416914-28416936 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1136426240 16:30170003-30170025 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1136613695 16:31382521-31382543 CCCACCCTCTGGGATGGAAGGGG - Exonic
1136865813 16:33752270-33752292 CTCACCACCTGGGATGTGAGAGG - Intergenic
1137388122 16:48059296-48059318 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1137388166 16:48059442-48059464 CACCCCGTCTGGGAAGTGAGGGG - Intergenic
1137430785 16:48416735-48416757 CGCCCCGTCTGGGAAGTGAGGGG - Intronic
1137780184 16:51091392-51091414 CCCATCTTCTGGGAAGCAAGAGG - Intergenic
1138043661 16:53698794-53698816 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1138400393 16:56739809-56739831 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1138400494 16:56740035-56740057 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1138467002 16:57200495-57200517 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1138467173 16:57200918-57200940 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1138642233 16:58396224-58396246 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1140395560 16:74623579-74623601 CTCATCATCTAGGATGTGAGTGG - Exonic
1140496593 16:75394461-75394483 CCCATCCTCTGTGATCTTAGAGG - Intronic
1203106341 16_KI270728v1_random:1363833-1363855 CTCACCACCTGGGATGTGAGAGG + Intergenic
1203127173 16_KI270728v1_random:1598535-1598557 CTCACCACCTGGGATGTGAGAGG - Intergenic
1143667771 17:8374068-8374090 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
1144484206 17:15651526-15651548 CCCAGAGTCTGGGCTGAGAGGGG + Exonic
1144524574 17:15979578-15979600 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1144524807 17:15980122-15980144 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1144536552 17:16095730-16095752 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1144716897 17:17442376-17442398 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1145174221 17:20685367-20685389 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1145206002 17:20984970-20984992 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1145862872 17:28224005-28224027 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1145862947 17:28224181-28224203 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1145896223 17:28459169-28459191 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1145920081 17:28604043-28604065 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1146444174 17:32922292-32922314 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1147963514 17:44180956-44180978 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1148404408 17:47398139-47398161 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1148406531 17:47420890-47420912 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1148632954 17:49125904-49125926 CGCACCGTCTGGGAGGTGAGGGG + Intergenic
1148966999 17:51444082-51444104 CCCATTGTGGGGGATGGGAGTGG + Intergenic
1149909067 17:60551825-60551847 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1149909139 17:60552001-60552023 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1149909263 17:60552277-60552299 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1152672772 17:81618609-81618631 CCGCCCGTCTGGGAGGTGAGGGG + Intronic
1152824169 17:82453775-82453797 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1153882131 18:9430573-9430595 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1154265268 18:12874329-12874351 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1154265311 18:12874435-12874457 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1154290031 18:13098717-13098739 CCCATCATCTGGGATGTGAGGGG - Intronic
1154943444 18:21137635-21137657 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1154943455 18:21137672-21137694 CCCTTCGTCTGGGAGGTGAGGGG - Intergenic
1154943480 18:21137748-21137770 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1154990103 18:21592338-21592360 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1155956611 18:31960688-31960710 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1156326228 18:36077575-36077597 CTCCCCGTCTGGGAGGTGAGGGG - Intergenic
1157591828 18:48840875-48840897 CCCATCTTCTGGGGTGGGGGTGG - Intronic
1157598770 18:48879791-48879813 CCCACCAGCTGTGATGTGAGTGG + Intergenic
1158148684 18:54343573-54343595 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1159054473 18:63450489-63450511 CGCCCCGTCCGGGATGTGAGGGG - Intergenic
1160494923 18:79367704-79367726 CCCATCACCAGGGATGAGAGAGG + Intronic
1160921015 19:1520620-1520642 CCTGTGGTCTGGGATGTGAGAGG + Intergenic
1161124397 19:2547666-2547688 CCCAGTGTCTGGGATGTGCTGGG - Intronic
1162887060 19:13703803-13703825 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1163143091 19:15363255-15363277 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1163542371 19:17918720-17918742 CGCCCCGTCTGGGAAGTGAGGGG + Intergenic
1163905726 19:20149679-20149701 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1163909494 19:20176362-20176384 CCCATCGTCTGGGATGTGAGGGG - Intronic
1164081630 19:21865612-21865634 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1164105658 19:22106876-22106898 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1164105811 19:22107233-22107255 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1164105884 19:22107408-22107430 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1164192229 19:22926450-22926472 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1164192533 19:22927133-22927155 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1164652372 19:29899335-29899357 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1164652631 19:29899917-29899939 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1164652967 19:29900674-29900696 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1165192768 19:34079078-34079100 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
1165199513 19:34132948-34132970 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1165842607 19:38797941-38797963 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1166028356 19:40108273-40108295 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1166028431 19:40108449-40108471 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1166180125 19:41103008-41103030 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1166261644 19:41644905-41644927 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1166278004 19:41768689-41768711 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1166640295 19:44489180-44489202 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1166977674 19:46614240-46614262 GCCACCCTCTGGGAAGTGAGGGG - Intergenic
1167138410 19:47632493-47632515 CCCATCACCTGGGATGTGCCAGG - Intronic
1167540960 19:50086698-50086720 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
926498044 2:13616310-13616332 CCCACAATCTGGGAAGTGAGGGG + Intergenic
926675086 2:15612348-15612370 CCCATCGTCTGAGATGTGGGGGG - Intronic
927776836 2:25910306-25910328 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
928597048 2:32868950-32868972 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
929416149 2:41747241-41747263 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
929614615 2:43297625-43297647 CCCCCCGTCCGGGAGGTGAGGGG + Intronic
929690123 2:44067111-44067133 CGCCTTGTCTGGGAGGTGAGGGG - Intergenic
930201999 2:48556481-48556503 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
930704014 2:54486125-54486147 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
930821562 2:55651179-55651201 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
931744844 2:65282802-65282824 CCCAGTGTCAGGGGTGTGAGTGG + Intergenic
931789985 2:65656322-65656344 CACTTAGTCTGGGATCTGAGTGG + Intergenic
932807299 2:74795678-74795700 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
932833680 2:75014020-75014042 CCCATCCTGTTGGATGAGAGGGG + Intergenic
933868986 2:86549096-86549118 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
933869000 2:86549133-86549155 CGCCCCGTCTGGGACGTGAGGGG - Intronic
934309783 2:91852164-91852186 CGCCCCGTCTGGGACGTGAGGGG + Intergenic
934634334 2:95969137-95969159 CTCACCTCCTGGGATGTGAGAGG - Intronic
934703617 2:96462003-96462025 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
934799298 2:97136102-97136124 CTCACCTCCTGGGATGTGAGAGG + Intronic
934834143 2:97567367-97567389 CTCACCTCCTGGGATGTGAGAGG - Intronic
935636257 2:105251548-105251570 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
936404385 2:112189153-112189175 CCCACCTTCTGGCATGTGAGAGG - Intergenic
936546316 2:113394752-113394774 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
936546390 2:113394928-113394950 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
937168593 2:119844063-119844085 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
937168669 2:119844240-119844262 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
937919403 2:127119620-127119642 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
937919473 2:127119795-127119817 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
938005850 2:127788157-127788179 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
938746005 2:134278904-134278926 ACAAACCTCTGGGATGTGAGGGG - Intronic
938828779 2:135033203-135033225 CGCCTCGTCTGGGAGATGAGGGG - Intronic
939578476 2:143922123-143922145 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
939584697 2:143991588-143991610 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
939584790 2:143991811-143991833 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
941024027 2:160439399-160439421 CGCCCCGTCCGGGATGTGAGGGG - Intronic
941769077 2:169327784-169327806 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
941814656 2:169786202-169786224 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
942630364 2:177946131-177946153 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
943418372 2:187636927-187636949 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
944262894 2:197696021-197696043 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
944283355 2:197922864-197922886 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
944283432 2:197923040-197923062 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
945114791 2:206400599-206400621 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
945114896 2:206400827-206400849 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
945114969 2:206401002-206401024 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
946411276 2:219516412-219516434 CCCACAGTCAGGTATGTGAGGGG + Intronic
946742688 2:222816593-222816615 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
947798058 2:232906423-232906445 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1169317182 20:4602445-4602467 CCCATCATGTGGGATGAGATGGG - Intergenic
1170202621 20:13760784-13760806 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1170424785 20:16227307-16227329 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1170424835 20:16227434-16227456 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1170811446 20:19678297-19678319 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172059204 20:32176495-32176517 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1172059278 20:32176671-32176693 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1172059354 20:32176847-32176869 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1172059508 20:32177199-32177221 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1172209075 20:33185102-33185124 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1172274170 20:33670785-33670807 CCCATCATCTGGGGTGGCAGGGG + Exonic
1172279519 20:33699762-33699784 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1172279593 20:33699937-33699959 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1172279667 20:33700111-33700133 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1172349320 20:34229399-34229421 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172349394 20:34229575-34229597 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172349470 20:34229751-34229773 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172349643 20:34230152-34230174 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172349717 20:34230328-34230350 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172349792 20:34230504-34230526 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172465641 20:35153859-35153881 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1172574982 20:36001454-36001476 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1172717664 20:36976668-36976690 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1172736006 20:37126430-37126452 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1176797581 21:13380926-13380948 CCCATCGTCTGGGATGTGAGAGG + Intergenic
1177178360 21:17720275-17720297 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1178075668 21:29011793-29011815 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1179380763 21:40897252-40897274 CCCATGGCCTGTGATGGGAGGGG - Intergenic
1179969261 21:44825103-44825125 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1179969375 21:44825340-44825362 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1180706534 22:17813709-17813731 CCCATTTTCTGGGCTGGGAGGGG + Intronic
1181617509 22:24065106-24065128 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1181715375 22:24723449-24723471 CCCTTCCCCTGGGATGTGGGTGG - Intronic
1182616249 22:31591864-31591886 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1182616376 22:31592140-31592162 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1182616448 22:31592316-31592338 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1182616576 22:31592592-31592614 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1182616648 22:31592768-31592790 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1182976157 22:34625865-34625887 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1183595295 22:38807282-38807304 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1183595369 22:38807458-38807480 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1183742334 22:39675738-39675760 CCCATGGACTGGGCTTTGAGGGG + Intronic
1183841119 22:40501287-40501309 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1183841193 22:40501463-40501485 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1183841267 22:40501639-40501661 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1183841316 22:40501766-40501788 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1183841389 22:40501942-40501964 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1183845376 22:40537267-40537289 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1183845450 22:40537443-40537465 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1183845524 22:40537619-40537641 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1183845623 22:40537845-40537867 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1184169448 22:42750541-42750563 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1185044568 22:48522658-48522680 CCCATGGCCTGGGCTGTGAAGGG - Intronic
1185218474 22:49616942-49616964 CCCTTCCTCTGGGATGGCAGAGG - Intronic
1185360409 22:50403479-50403501 CCCACCCTGTGGGATGTCAGAGG - Intronic
950253627 3:11487551-11487573 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
951013335 3:17704786-17704808 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
951013408 3:17704962-17704984 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
953307148 3:41841309-41841331 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
953307193 3:41841456-41841478 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
953328419 3:42032025-42032047 CCCATCTTCTGAAAAGTGAGGGG + Intronic
953357666 3:42268033-42268055 CCCAGAGTCTGGCATGTGGGTGG + Intergenic
953426160 3:42798111-42798133 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
953426340 3:42798516-42798538 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
953855277 3:46495086-46495108 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
953918126 3:46933570-46933592 TGCAGCGTCTGGGATGAGAGTGG - Intronic
954059526 3:48056517-48056539 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
954059600 3:48056693-48056715 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
954080862 3:48211840-48211862 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
954080936 3:48212016-48212038 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
954162940 3:48734764-48734786 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
954162971 3:48734842-48734864 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
954483476 3:50823755-50823777 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
955297584 3:57747985-57748007 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
955362838 3:58289952-58289974 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
955362963 3:58290255-58290277 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
955394737 3:58549887-58549909 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
955394787 3:58550014-58550036 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
955434887 3:58890525-58890547 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
955674450 3:61434685-61434707 CGCCCCGTCCGGGATGTGAGGGG - Intergenic
956270567 3:67444412-67444434 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
956270696 3:67444718-67444740 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
956270771 3:67444896-67444918 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
956404219 3:68911456-68911478 CCCATCACCTGGGGTGTGTGAGG - Intronic
957316651 3:78583170-78583192 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
957316726 3:78583346-78583368 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
957839351 3:85647072-85647094 CTCATCGTCTATAATGTGAGAGG + Intronic
958406894 3:93763494-93763516 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
958406932 3:93763606-93763628 CACCCCGTCTGGGAGGTGAGTGG - Intergenic
958808647 3:98837604-98837626 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
958808723 3:98837780-98837802 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
958957441 3:100478045-100478067 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
959042826 3:101439801-101439823 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
959042899 3:101439976-101439998 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
959419279 3:106111692-106111714 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
960388702 3:117050883-117050905 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
960862206 3:122164958-122164980 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
961330876 3:126137207-126137229 CCAATCCACAGGGATGTGAGTGG - Intronic
961729362 3:128954768-128954790 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
962063312 3:131952646-131952668 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
962112768 3:132470753-132470775 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
962245022 3:133785024-133785046 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
962245096 3:133785200-133785222 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
962572262 3:136723684-136723706 CACCCCGTCTGGGAGGTGAGGGG + Intronic
963248915 3:143086383-143086405 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
963911395 3:150820561-150820583 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
966359790 3:179120469-179120491 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
966359860 3:179120645-179120667 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
966360112 3:179121195-179121217 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
967417205 3:189232550-189232572 ACAATCCTCTGAGATGTGAGGGG - Intronic
968667607 4:1829307-1829329 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
968919273 4:3514374-3514396 CACAGCCCCTGGGATGTGAGGGG - Intronic
969258663 4:6020364-6020386 CCCAGCGCCTGGGATCTGAGTGG - Intergenic
969260324 4:6029264-6029286 CACGTCTTCTGGGATGGGAGAGG + Intronic
970248342 4:14087977-14087999 CCCCTCCCCTTGGATGTGAGTGG - Intergenic
970472651 4:16393347-16393369 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
972288328 4:37669083-37669105 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
973109105 4:46377543-46377565 CACCCCGTCTGGGAAGTGAGGGG + Intronic
973281284 4:48363530-48363552 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
973281358 4:48363706-48363728 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
973593611 4:52465358-52465380 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
973672983 4:53238140-53238162 CACCCCGTCTGGGAGGTGAGGGG - Intronic
974526901 4:63057760-63057782 CCCATCCTCTGGGAGAAGAGTGG - Intergenic
975263596 4:72334642-72334664 CCCATCGTCTGCCATGTGCAAGG - Intronic
975803099 4:78083229-78083251 CCCATCCTCTGGCTTGTGACTGG + Intronic
976340763 4:83943595-83943617 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
976340814 4:83943722-83943744 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
978376167 4:108077410-108077432 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978376192 4:108077490-108077512 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978376205 4:108077530-108077552 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978376218 4:108077570-108077592 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978376231 4:108077610-108077632 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978376244 4:108077650-108077672 CGCCCCGTCTGGGAAGTGAGGGG + Intronic
978518832 4:109597322-109597344 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
978888700 4:113796522-113796544 CGCCCCGTCTGGGATGTGAGGGG + Intergenic
979264437 4:118685003-118685025 CCACTCGTCTAGGAAGTGAGAGG + Intergenic
979622544 4:122812423-122812445 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
979641540 4:123016123-123016145 CACCCCGTCTGGGAGGTGAGGGG - Intronic
979941837 4:126771488-126771510 CACCTCGTCTGGGAGGTGGGGGG + Intergenic
981229038 4:142331520-142331542 CATATCATCTGGCATGTGAGAGG - Intronic
981524209 4:145694400-145694422 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
981677520 4:147358139-147358161 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
982053455 4:151526347-151526369 CGCCTCGTCTGGGAGGTGAGGGG - Intronic
982615758 4:157636767-157636789 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
982615876 4:157637044-157637066 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
982784449 4:159523833-159523855 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
982784813 4:159524679-159524701 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
982820685 4:159939303-159939325 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
982820763 4:159939478-159939500 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
982820865 4:159939703-159939725 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
983652367 4:170046837-170046859 CGCACCGTCCGGGAGGTGAGGGG + Intergenic
983834593 4:172372270-172372292 CCCATCGTCTGGGAGAAAAGTGG + Intronic
984004700 4:174294633-174294655 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
985255686 4:188068128-188068150 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
985831844 5:2239737-2239759 TCCATCTCCTGGGATGTGAGGGG - Intergenic
988532863 5:32040972-32040994 CACCCCGTCTGGGAGGTGAGGGG + Intronic
988532876 5:32041009-32041031 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
988552186 5:32208502-32208524 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
988552419 5:32209040-32209062 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
988760520 5:34306542-34306564 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
989021354 5:37013018-37013040 CCCCCCGTCCGGGAGGTGAGGGG - Intronic
989575111 5:42980780-42980802 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
990461975 5:56038831-56038853 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
990709214 5:58563665-58563687 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
991446975 5:66710700-66710722 CCCGCCGTCTGGGTTGTCAGTGG + Intronic
991910160 5:71552241-71552263 CCCATCATCTGAGATGTGGGGGG - Intronic
992289834 5:75270844-75270866 CGCCTCGTCTGGGAGGTGAGGGG + Intergenic
992289904 5:75271020-75271042 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
992374045 5:76172014-76172036 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
992407655 5:76475143-76475165 CCCTTCCTCTGGGATGAGAGGGG + Intronic
992443071 5:76812599-76812621 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
992443138 5:76812768-76812790 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
992469819 5:77043094-77043116 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
992469893 5:77043270-77043292 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
992469967 5:77043446-77043468 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
992544274 5:77795081-77795103 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
992574740 5:78097410-78097432 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
992978207 5:82140094-82140116 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
993162900 5:84312696-84312718 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
993657584 5:90595299-90595321 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
995193400 5:109341677-109341699 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
995193500 5:109341902-109341924 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
997874668 5:137537584-137537606 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
998239213 5:140427234-140427256 CACCCCGTCTGGGAGGTGAGGGG - Intronic
998431919 5:142075898-142075920 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
998431995 5:142076074-142076096 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1000032861 5:157419368-157419390 CACCCCGTCTGGGAAGTGAGGGG + Intronic
1000985504 5:167859634-167859656 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1000985577 5:167859810-167859832 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1001195857 5:169673102-169673124 CCCAACCTCTGGGAGGGGAGGGG - Intronic
1001394029 5:171403823-171403845 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1002013735 5:176305217-176305239 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1002013826 5:176305432-176305454 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1002013901 5:176305608-176305630 CCCCCCGTCTGGGAGGTGAGGGG + Intronic
1002031667 5:176434220-176434242 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1002115914 5:176961794-176961816 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1002529399 5:179834993-179835015 CACCCCGTCCGGGATGTGAGGGG - Intronic
1002658271 5:180771265-180771287 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1002878769 6:1234224-1234246 CACATCCTCTGTGATGTCAGAGG + Intergenic
1003888057 6:10538801-10538823 ACCATCTTCTGGGATCTCAGAGG + Intronic
1004388259 6:15189390-15189412 CTCCCCGTCTGGGAGGTGAGGGG + Intergenic
1004414776 6:15415404-15415426 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1004414934 6:15415781-15415803 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1005063297 6:21796848-21796870 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1005606833 6:27485145-27485167 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1005606906 6:27485321-27485343 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1005933206 6:30498903-30498925 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1006039773 6:31244157-31244179 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1006039849 6:31244333-31244355 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1006128302 6:31854051-31854073 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1006148911 6:31975996-31976018 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1006149126 6:31976620-31976642 CACCCCGTCTGGGAAGTGAGGGG - Intronic
1006492475 6:34397999-34398021 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1006492547 6:34398175-34398197 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1006617641 6:35340720-35340742 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1006623771 6:35384337-35384359 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1006623921 6:35384688-35384710 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1006623997 6:35384863-35384885 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1006733917 6:36258366-36258388 CCCCTAGTCAGGGATGTGTGGGG - Intronic
1007674217 6:43580852-43580874 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1008553634 6:52655847-52655869 CGCCTCGTCCGGGAGGTGAGGGG - Intergenic
1008841483 6:55909907-55909929 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1008841558 6:55910083-55910105 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1008965628 6:57311074-57311096 CACCCCGTCTGGGAAGTGAGGGG - Intergenic
1008965641 6:57311114-57311136 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1008965668 6:57311188-57311210 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1010264473 6:73851384-73851406 CCCATCATCTGAGATGTGGGGGG - Intergenic
1010374955 6:75156999-75157021 CTCATAGTCTGAGATGTGCGTGG - Intronic
1011405129 6:87009971-87009993 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1011476042 6:87751137-87751159 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1013045134 6:106478056-106478078 CCCCTAAGCTGGGATGTGAGTGG + Intergenic
1013326149 6:109047245-109047267 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1014556835 6:122848811-122848833 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1014774671 6:125494712-125494734 CCCATCAACTGGAATGTTAGTGG - Intergenic
1015476855 6:133665234-133665256 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1015476926 6:133665410-133665432 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1016292202 6:142538276-142538298 CCCATCTTCTGGGGTGAGGGTGG - Intergenic
1017493706 6:154966189-154966211 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1017843209 6:158239017-158239039 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1017843261 6:158239144-158239166 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1017843520 6:158239726-158239748 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1017843699 6:158240129-158240151 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1017843826 6:158240432-158240454 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1017843900 6:158240609-158240631 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1019182599 6:170200444-170200466 CCCTGCTTCTGGGATGTGGGCGG - Intergenic
1019439397 7:1038734-1038756 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1019439470 7:1038910-1038932 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1019459528 7:1149561-1149583 CCCACCGTCAGGGATGTGCACGG + Intergenic
1019669224 7:2268626-2268648 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1019671472 7:2282059-2282081 CCCTTGGCCTGGGATCTGAGGGG - Intronic
1019674624 7:2303359-2303381 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1020616222 7:10465313-10465335 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1020616272 7:10465440-10465462 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1020616322 7:10465567-10465589 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1020616419 7:10465793-10465815 CCCTCCGTCCGGGAGGTGAGGGG - Intergenic
1021647493 7:22801252-22801274 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1021672304 7:23046189-23046211 CACCTCGTCCGGGAGGTGAGGGG - Intergenic
1021842461 7:24732009-24732031 CCCAAGGTCTGGGATGGGAGGGG - Intronic
1021872461 7:25018907-25018929 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1021872511 7:25019036-25019058 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1023160755 7:37293123-37293145 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1023848951 7:44139944-44139966 CACCTCTTCTGGGATGTGGGAGG - Intronic
1023954044 7:44871234-44871256 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1023954071 7:44871308-44871330 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1023954140 7:44871539-44871561 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1023954236 7:44871836-44871858 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1024109866 7:46134143-46134165 CCCTTCATGTGGGATGGGAGAGG + Intergenic
1024989047 7:55220022-55220044 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1025103390 7:56151757-56151779 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1025796099 7:64739142-64739164 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1025800923 7:64785109-64785131 CCTCCCGTCTGGGAGGTGAGGGG + Intergenic
1025808398 7:64856621-64856643 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1026163590 7:67890590-67890612 CCAACCATCTGGGAAGTGAGGGG + Intergenic
1026187190 7:68091118-68091140 CCCATTATCTGGGAGGTGTGGGG - Intergenic
1027371281 7:77509680-77509702 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1027371356 7:77509856-77509878 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1028790666 7:94849791-94849813 CACACTGTCTGGGAAGTGAGGGG - Intergenic
1029334500 7:99888250-99888272 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1029468814 7:100741699-100741721 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1030326929 7:108229742-108229764 ACCAGAGTTTGGGATGTGAGAGG - Intronic
1032129459 7:129216382-129216404 CCCATCGTCTGGGATGTGAGGGG + Intergenic
1033138083 7:138801357-138801379 CCCAGGGTCTGGGTGGTGAGCGG - Exonic
1033323812 7:140362451-140362473 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1033376067 7:140763197-140763219 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1034234379 7:149555250-149555272 CCGCCCGTCTGGGAGGTGAGGGG + Intergenic
1034322588 7:150198832-150198854 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1035758146 8:2049559-2049581 CCCATGGCCCGGGATGTGGGTGG + Intronic
1035925578 8:3724561-3724583 CCCTTCCTCTGGGCTGGGAGAGG + Intronic
1036536567 8:9657386-9657408 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1036536641 8:9657562-9657584 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1039153202 8:34528923-34528945 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1040069891 8:43180022-43180044 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1040093153 8:43419212-43419234 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1040834662 8:51719060-51719082 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1041070832 8:54125520-54125542 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1041070980 8:54125845-54125867 CGCCTCGTCCGGGAGGTGAGGGG + Intergenic
1041791252 8:61698602-61698624 CCCAACCTCTGGGAGGAGAGAGG - Intronic
1041796458 8:61752817-61752839 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1041851203 8:62395202-62395224 CCCTCGGTCTGGGAAGTGAGGGG - Intronic
1041851234 8:62395297-62395319 CCCACCGTCTGGGAAGTGAGGGG - Intronic
1042049132 8:64686130-64686152 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1042303595 8:67311012-67311034 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1044581986 8:93833718-93833740 CACCCCGTCTGGGAGGTGAGAGG - Intergenic
1044582034 8:93833865-93833887 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1044582046 8:93833902-93833924 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1044582084 8:93834015-93834037 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1044582172 8:93834306-93834328 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1044660779 8:94591150-94591172 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1044660854 8:94591327-94591349 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1046636852 8:116680104-116680126 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1046945457 8:119970450-119970472 GCCTTGGTCTGGGATGTGACTGG + Intronic
1047266936 8:123315608-123315630 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1047266987 8:123315735-123315757 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1047388523 8:124431882-124431904 CGCCTCGTCTGGGAGGTGAGGGG - Intergenic
1047847948 8:128826196-128826218 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1047938142 8:129801723-129801745 CCCATCCTCTGGGATGTTGTAGG - Intergenic
1049633111 8:143670069-143670091 GGCATCGTCTGGGAAGTGAGGGG - Intergenic
1050417847 9:5434184-5434206 CACCCCGTCTGGGAGGTGAGGGG + Intronic
1050417933 9:5434448-5434470 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1051258182 9:15234434-15234456 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1051277077 9:15407133-15407155 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1051668572 9:19488247-19488269 CCCTTGTTCTGGGATCTGAGAGG + Intergenic
1052259200 9:26493066-26493088 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1053457384 9:38242492-38242514 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1053457458 9:38242668-38242690 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1055137377 9:72841195-72841217 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1055138619 9:72851192-72851214 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1055231670 9:74074157-74074179 CCCACCTTCTGAGAAGTGAGGGG - Intergenic
1055363341 9:75518893-75518915 CACATCTTTTGGGATGTGGGAGG + Intergenic
1055414060 9:76063919-76063941 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1055414132 9:76064095-76064117 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1055948469 9:81710766-81710788 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1055948544 9:81710942-81710964 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1056152543 9:83804150-83804172 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1056229184 9:84526890-84526912 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1056229210 9:84526963-84526985 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1056229301 9:84527221-84527243 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1056229327 9:84527301-84527323 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1056392445 9:86152367-86152389 CCCATCTTCTGGGATAAAAGTGG + Intergenic
1056564160 9:87758526-87758548 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1056564326 9:87758945-87758967 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1056576068 9:87857127-87857149 CCCACCATCTGAGAAGTGAGGGG - Intergenic
1057154666 9:92830654-92830676 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1057630428 9:96715585-96715607 CGCCCCGTCTGGGAAGTGAGGGG - Intergenic
1057674768 9:97130356-97130378 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1057674782 9:97130393-97130415 CACCCCGTCTGGGATGTGGGGGG - Intergenic
1058244147 9:102603345-102603367 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1058659749 9:107257240-107257262 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1058722669 9:107776519-107776541 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1059121011 9:111641254-111641276 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1059121085 9:111641430-111641452 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1059211203 9:112514705-112514727 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060065121 9:120496056-120496078 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060065195 9:120496232-120496254 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060651205 9:125328790-125328812 CGCCTCGTCCGGGAGGTGAGGGG - Intronic
1060682405 9:125577464-125577486 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060687253 9:125624060-125624082 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060687325 9:125624236-125624258 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1060960418 9:127676739-127676761 CCCATCGTCACCGATGTAAGAGG + Exonic
1061982699 9:134115597-134115619 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061982773 9:134115773-134115795 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061982849 9:134115949-134115971 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983023 9:134116351-134116373 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983097 9:134116527-134116549 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983173 9:134116703-134116725 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983324 9:134117056-134117078 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983398 9:134117232-134117254 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983474 9:134117408-134117430 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983648 9:134117810-134117832 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983722 9:134117986-134118008 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1061983798 9:134118162-134118184 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1062645392 9:137545312-137545334 TCCATCCCCTGGGATTTGAGGGG - Intronic
1187844517 X:23522938-23522960 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1188477286 X:30602751-30602773 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1189210520 X:39278415-39278437 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1189421746 X:40862780-40862802 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1189955908 X:46275744-46275766 CGCCCCGTCTGGGAGGTGAGGGG + Intergenic
1189968481 X:46395923-46395945 CACCCCGTCTGGGAGGTGAGGGG - Intergenic
1190153135 X:47965480-47965502 CCAACTGTCTGGGAAGTGAGGGG + Intronic
1190171650 X:48115753-48115775 CCCCCCGTCCGGGAGGTGAGGGG + Intergenic
1190210308 X:48441644-48441666 CACATCTGCAGGGATGTGAGGGG - Intergenic
1190779327 X:53579099-53579121 CGCCCCGTCTGGGAGGTGAGGGG + Intronic
1191010068 X:55749087-55749109 CGCCTCGTCCGGGAGGTGAGTGG + Intronic
1192198872 X:69050889-69050911 CCCATGGTATGTGATGTGAAGGG - Intergenic
1192505047 X:71676329-71676351 CGCCCCGTCTGGGAAGTGAGGGG + Intergenic
1192663974 X:73069217-73069239 CGCTCCGTCTGGGAGGTGAGGGG + Intergenic
1193068171 X:77279707-77279729 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1193345151 X:80396863-80396885 CACCCCGTCTGGGAGGTGAGGGG - Intronic
1194001649 X:88437050-88437072 CTCATCTTCTGGCATTTGAGAGG + Intergenic
1195036013 X:100972446-100972468 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1195354023 X:104021388-104021410 CCCAGGGTCTGGGACGTGGGTGG + Intergenic
1196404331 X:115347402-115347424 CGCCCCGTCTGGGAGGTGAGGGG - Intergenic
1198246981 X:134839765-134839787 CGCCTCGTCCGGGAGGTGAGGGG + Intronic
1199452633 X:147992425-147992447 CGCCCCGTCTGGGAGGTGAGGGG - Intronic
1199849486 X:151715292-151715314 CCCATCCTCGATGATGTGAGTGG - Intergenic
1202028893 Y:20552204-20552226 CACCCCGTCTGGGAGGTGAGGGG + Intergenic
1202243184 Y:22791066-22791088 CCCATCCTCTGGGATAAAAGTGG - Intergenic
1202396171 Y:24424816-24424838 CCCATCCTCTGGGATAAAAGTGG - Intergenic
1202474614 Y:25245276-25245298 CCCATCCTCTGGGATAAAAGTGG + Intergenic
1202586173 Y:26430307-26430329 CTCACCTCCTGGGATGTGAGAGG + Intergenic