ID: 910891733

View in Genome Browser
Species Human (GRCh38)
Location 1:92026424-92026446
Sequence GCCCATCGTCTGGGATGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 5, 1: 3, 2: 2, 3: 12, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910891733_910891747 19 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891747 1:92026466-92026488 TCACTTCCCAGATGGGGTGGGGG 0: 143
1: 1502
2: 3062
3: 3898
4: 2022
910891733_910891748 23 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891748 1:92026470-92026492 TTCCCAGATGGGGTGGGGGCCGG No data
910891733_910891749 24 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891749 1:92026471-92026493 TCCCAGATGGGGTGGGGGCCGGG No data
910891733_910891746 18 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891733_910891745 17 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891745 1:92026464-92026486 CCTCACTTCCCAGATGGGGTGGG No data
910891733_910891741 12 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891741 1:92026459-92026481 ACGCTCCTCACTTCCCAGATGGG 0: 462
1: 2987
2: 5658
3: 4727
4: 7843
910891733_910891742 13 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891742 1:92026460-92026482 CGCTCCTCACTTCCCAGATGGGG 0: 516
1: 2852
2: 4749
3: 9803
4: 5601
910891733_910891740 11 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891740 1:92026458-92026480 GACGCTCCTCACTTCCCAGATGG 0: 2075
1: 3551
2: 4573
3: 7634
4: 4758
910891733_910891752 30 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891752 1:92026477-92026499 ATGGGGTGGGGGCCGGGCAGAGG No data
910891733_910891743 16 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891743 1:92026463-92026485 TCCTCACTTCCCAGATGGGGTGG 0: 697
1: 4115
2: 10358
3: 4229
4: 3475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910891733 Original CRISPR GCCCATCGTCTGGGATGTGA GGG (reversed) Intergenic
901341482 1:8501517-8501539 GCCCCCCGTCCGGGAGGTGAGGG + Intronic
902815352 1:18913394-18913416 TCCCAGCGTCTGGGATCTGAAGG + Intronic
903485931 1:23689156-23689178 GCCCCCCGTCCGGGAGGTGAGGG + Intergenic
904831571 1:33309358-33309380 GCCCCCCGTCTGGGAGGTGGGGG - Intronic
908512244 1:64858698-64858720 GCTCATATTCTGGGAGGTGAGGG + Intronic
910891733 1:92026424-92026446 GCCCATCGTCTGGGATGTGAGGG - Intergenic
912789994 1:112640499-112640521 GCCCCCCGTCCGGGAGGTGAGGG + Intronic
914908989 1:151769377-151769399 CCGCCTCGTCTGGGAAGTGAGGG - Intronic
916424316 1:164666140-164666162 GGACATCCTCTGGGAGGTGAGGG - Intronic
921756523 1:218862991-218863013 GAGCATTGTCTGGAATGTGAGGG + Intergenic
922228513 1:223665995-223666017 GCCCATTGACTGAGATGAGAAGG + Intergenic
922933391 1:229407302-229407324 GCGCGTCCTCTGGGATTTGAAGG + Intergenic
1063013280 10:2048258-2048280 GCCCTTCTTCTGGGCTCTGAAGG - Intergenic
1064108306 10:12519330-12519352 GCCCCCCGTCCGGGAGGTGAGGG - Intronic
1070890814 10:79941313-79941335 GCCCCTCCTCTGGGATGAGGAGG + Intronic
1072013537 10:91323828-91323850 GCCCATCGTCTGGGATGCGAGGG - Intergenic
1075647322 10:124104998-124105020 GCCCAGCCTCTGAGAAGTGAAGG + Intergenic
1075978362 10:126716418-126716440 GACCATCCTCTTGGATGTGAAGG - Intergenic
1078570407 11:12452987-12453009 GCCCATGGTCTAGGATTTCATGG - Intronic
1080538356 11:33243696-33243718 CCGCCCCGTCTGGGATGTGAGGG + Intergenic
1080878644 11:36299138-36299160 GGCCAACCTCTGGGATGTGTAGG - Intronic
1081158607 11:39726145-39726167 GGCTTTCTTCTGGGATGTGAGGG + Intergenic
1083624073 11:64062998-64063020 GCCCATCTTCCGAGCTGTGAGGG + Intronic
1084529173 11:69717045-69717067 GCCAAGCGGCTGGGATGTGGGGG + Intergenic
1089294248 11:117458466-117458488 GCCCATGGTGTGGGAGGAGAGGG + Intronic
1090686617 11:129129077-129129099 CCGCCCCGTCTGGGATGTGAAGG + Intronic
1091766761 12:3125900-3125922 GCACATCGCCTGGCATTTGAGGG + Intronic
1092331387 12:7590119-7590141 CCCCCTCGTCTGGGAGGTGAGGG - Intergenic
1092436604 12:8452223-8452245 ACCCACTGTCTGGGAAGTGAGGG - Intergenic
1095841586 12:46699871-46699893 GCCCATGACCTGGGCTGTGATGG - Intergenic
1096441033 12:51644692-51644714 GCCCATCGTCTGGGATGTGAGGG + Intronic
1097626783 12:62010758-62010780 CCCCCCCGTCTGGGAGGTGAGGG + Intronic
1097626851 12:62010953-62010975 GCCCTTCGTCTGGGAGGTGGGGG + Intronic
1099257083 12:80327635-80327657 GCCAATCTGCTTGGATGTGAGGG + Intronic
1102029630 12:109732470-109732492 GCCCATTGTCTGGCATGTGGGGG + Intronic
1103017653 12:117508335-117508357 GCTTTTCTTCTGGGATGTGATGG - Intronic
1103350081 12:120278102-120278124 GCCCATCGTCTGGGATGTGAGGG - Intergenic
1103350121 12:120278215-120278237 GCCCTTCATCTGGGAGGTGGGGG - Intergenic
1104962538 12:132495111-132495133 GCCCGTCGTGGGGAATGTGAGGG + Intronic
1105692882 13:22859287-22859309 CCGCCCCGTCTGGGATGTGAGGG - Intergenic
1105816247 13:24038926-24038948 GCCCATTGCCTGGGATGAGCAGG - Intronic
1114500741 14:23166445-23166467 TCTCATCGTCTGGATTGTGACGG - Exonic
1117098007 14:52316648-52316670 GCTCATCCTCAGGGATGGGAAGG + Intronic
1117548439 14:56811519-56811541 GCCCAGAGGCTGGGAAGTGATGG + Intergenic
1122771912 14:104101382-104101404 ACCCACTGTCTGGGAAGTGAGGG + Intronic
1123074750 14:105662473-105662495 GCCCAGAGTCTGGACTGTGATGG + Intergenic
1124378072 15:29141183-29141205 GCCCAGAGTCTGGGATCTGAGGG + Intronic
1125318768 15:38459584-38459606 GCCCATGGTCTGGGCTGGGCTGG + Intronic
1125511553 15:40294934-40294956 ACCCATCGTCTGGAAGTTGAGGG + Exonic
1128182298 15:65614757-65614779 CCCCAGGGTCTGGCATGTGATGG + Intronic
1128536320 15:68493297-68493319 GCCCTGTGTCTGGCATGTGATGG - Intergenic
1129332760 15:74836313-74836335 GCCCATGCTGTGGGCTGTGAAGG + Exonic
1133522517 16:6573089-6573111 GCCCATGGTCTAGGGTCTGAGGG - Intronic
1136613697 16:31382522-31382544 GCCCACCCTCTGGGATGGAAGGG - Exonic
1137499276 16:48997909-48997931 GCCCATGGTCAGGGCTGTGGGGG - Intergenic
1142515008 17:422173-422195 GCCCATTTCCTTGGATGTGATGG - Intronic
1142634303 17:1247317-1247339 ACCCATTGTCTGAGATGTGGGGG - Intergenic
1143408435 17:6693979-6694001 GCCAATCCTCTTGGATATGATGG + Intronic
1143529914 17:7496721-7496743 GCCCACCCTCTGGGCTCTGATGG + Intronic
1144641458 17:16939594-16939616 GGCCACTGTCTGGGATGTGTGGG + Exonic
1146372754 17:32275570-32275592 TCCCAACATCTGGGAAGTGAGGG - Intronic
1148190889 17:45677950-45677972 GCCCATCCTCTGGAGTGAGAAGG + Intergenic
1148632953 17:49125903-49125925 CCGCACCGTCTGGGAGGTGAGGG + Intergenic
1152672770 17:81618608-81618630 GCCGCCCGTCTGGGAGGTGAGGG + Intronic
1154290033 18:13098718-13098740 GCCCATCATCTGGGATGTGAGGG - Intronic
1154943457 18:21137673-21137695 ACCCTTCGTCTGGGAGGTGAGGG - Intergenic
1160662889 19:309250-309272 GCTCATGGTCTGGGATGGGGTGG - Intronic
1161124399 19:2547667-2547689 ACCCAGTGTCTGGGATGTGCTGG - Intronic
1161672854 19:5623725-5623747 TCCCCTCGCCTGGGAAGTGAGGG - Intronic
1163909496 19:20176363-20176385 GCCCATCGTCTGGGATGTGAGGG - Intronic
1166567120 19:43772063-43772085 GCCGATGGTCAGGAATGTGATGG + Exonic
926498029 2:13616270-13616292 CCCCACCATCTGGGAAGTGAGGG + Intergenic
926675088 2:15612349-15612371 GCCCATCGTCTGAGATGTGGGGG - Intronic
928254864 2:29713367-29713389 GACCATAGTCTGGGATGGGGAGG + Intronic
932773823 2:74515462-74515484 GCCCTTCCCCTGGGATGCGAGGG - Intronic
939216276 2:139242659-139242681 GCCCGCAGACTGGGATGTGATGG + Intergenic
943145380 2:184037495-184037517 TCTCATCCTCTGGGAAGTGATGG + Intergenic
947762053 2:232610283-232610305 GCCCAGCCTCAGGGATGGGAGGG - Intronic
948614156 2:239187599-239187621 GCCCATGGTCAGGGCCGTGAGGG + Intronic
1169317184 20:4602446-4602468 CCCCATCATGTGGGATGAGATGG - Intergenic
1173199435 20:40943810-40943832 GCCAGTCCTCTGGGATGGGAGGG + Intergenic
1173226356 20:41164515-41164537 GACAATCTTCTGGGCTGTGAGGG - Intronic
1179929071 21:44555428-44555450 GCTCATCCTGTGGGATGTGGGGG - Intronic
1180967423 22:19797890-19797912 GCAGAGCGTCTGGGATGTGCTGG - Intronic
1181770803 22:25123990-25124012 GCCCATGGTCTGTAATGTGTAGG + Intronic
1182550308 22:31097314-31097336 GCCCATCTTCTTGGATGAGGAGG - Exonic
1184629213 22:45762882-45762904 GTCCACAGTCTGGGCTGTGAGGG - Intronic
1185009499 22:48305322-48305344 ACCCAAAGTCTGGGATGTGGAGG + Intergenic
1185044570 22:48522659-48522681 TCCCATGGCCTGGGCTGTGAAGG - Intronic
1185185291 22:49395657-49395679 GCCCCTCGTGTGTGATGTGGGGG + Intergenic
953773131 3:45794000-45794022 GCCCAACCTCTGTGATGTGATGG - Intronic
965757638 3:172040965-172040987 TCCCTTCGTCTGGGATGGCAGGG - Intronic
968201881 3:196762119-196762141 GCCCATCGTCTGAGATGTGGGGG - Intronic
968689767 4:1984460-1984482 GCCCTCCGTCTGGGAGGGGATGG + Intronic
969528051 4:7714044-7714066 GCCCATGGGTTGGGATGAGAGGG + Intronic
977203254 4:94140939-94140961 GCTCATCCTCAGGGAGGTGACGG - Intergenic
978888699 4:113796521-113796543 CCGCCCCGTCTGGGATGTGAGGG + Intergenic
981145177 4:141315586-141315608 GCCCATCCTTTGGGTTGTGTAGG + Intergenic
982053456 4:151526348-151526370 CCGCCTCGTCTGGGAGGTGAGGG - Intronic
985020144 4:185680306-185680328 GCCCTTCTTCTAGGATTTGATGG + Intronic
985657618 5:1140279-1140301 CCTCATCGCCTGGGATGTGCTGG - Intergenic
985831845 5:2239738-2239760 CTCCATCTCCTGGGATGTGAGGG - Intergenic
989021356 5:37013019-37013041 GCCCCCCGTCCGGGAGGTGAGGG - Intronic
991910162 5:71552242-71552264 GCCCATCATCTGAGATGTGGGGG - Intronic
992289833 5:75270843-75270865 CCGCCTCGTCTGGGAGGTGAGGG + Intergenic
992407653 5:76475142-76475164 CCCCTTCCTCTGGGATGAGAGGG + Intronic
992415847 5:76551240-76551262 CCGCCCCGTCTGGGATGTGAGGG - Intronic
1002013899 5:176305607-176305629 CCCCCCCGTCTGGGAGGTGAGGG + Intronic
1006733919 6:36258367-36258389 GCCCCTAGTCAGGGATGTGTGGG - Intronic
1010264475 6:73851385-73851407 GCCCATCATCTGAGATGTGGGGG - Intergenic
1011407441 6:87030821-87030843 GCCATTGGGCTGGGATGTGAGGG - Intergenic
1019671474 7:2282060-2282082 GCCCTTGGCCTGGGATCTGAGGG - Intronic
1021842463 7:24732010-24732032 TCCCAAGGTCTGGGATGGGAGGG - Intronic
1022581740 7:31561960-31561982 GCCCATGGTCATGGATGTTAAGG + Intronic
1025030598 7:55553678-55553700 GCTCTTTATCTGGGATGTGATGG - Intronic
1025800921 7:64785108-64785130 GCCTCCCGTCTGGGAGGTGAGGG + Intergenic
1026163588 7:67890589-67890611 GCCAACCATCTGGGAAGTGAGGG + Intergenic
1028642235 7:93055142-93055164 GCACGTATTCTGGGATGTGAAGG + Intergenic
1031979997 7:128118704-128118726 CCCCTTGGTCTTGGATGTGATGG - Intergenic
1032129457 7:129216381-129216403 GCCCATCGTCTGGGATGTGAGGG + Intergenic
1034234377 7:149555249-149555271 GCCGCCCGTCTGGGAGGTGAGGG + Intergenic
1035289189 7:157826769-157826791 GCCCACCCTCTGGGATGCCATGG - Intronic
1035708963 8:1698193-1698215 CCCTGTCGTCTGGGATGAGAGGG - Intronic
1041061330 8:54037614-54037636 GCCCTTCGGGTGGGATGTGGTGG + Intergenic
1041851236 8:62395298-62395320 CCCCACCGTCTGGGAAGTGAGGG - Intronic
1047388524 8:124431883-124431905 TCGCCTCGTCTGGGAGGTGAGGG - Intergenic
1047991603 8:130292230-130292252 CCCCATTGTCTGGCATGTGTTGG - Intronic
1048108747 8:131442902-131442924 TCCCATGGTCTGGGATGATAGGG + Intergenic
1048651260 8:136480975-136480997 GCCTTTCATCTGGGATGTGCAGG + Intergenic
1049439252 8:142601736-142601758 GCCAAGAGTCTGGGCTGTGAAGG - Intergenic
1049633112 8:143670070-143670092 CGGCATCGTCTGGGAAGTGAGGG - Intergenic
1055414061 9:76063920-76063942 GCGCCCCGTCTGGGAGGTGAGGG - Intronic
1057448580 9:95136971-95136993 ACCCACTGTCTGGGATGTGCAGG - Intronic
1058952243 9:109914811-109914833 GCCCATCGTCAGGAATATGCTGG + Intronic
1059427838 9:114232157-114232179 GGCCAGCATCTGGGATTTGAAGG + Intronic
1061218212 9:129234205-129234227 GCCAATGGTCTGAGAGGTGAAGG + Intergenic
1062645393 9:137545313-137545335 GTCCATCCCCTGGGATTTGAGGG - Intronic
1187126116 X:16456030-16456052 TCCCATTGTATGGGATGTGCAGG + Intergenic
1188060129 X:25590751-25590773 GCACAGCGTCTGAGGTGTGAAGG - Intergenic
1190210309 X:48441645-48441667 GCACATCTGCAGGGATGTGAGGG - Intergenic
1192198874 X:69050890-69050912 ACCCATGGTATGTGATGTGAAGG - Intergenic
1195979075 X:110558855-110558877 CCCCACCATCTGGGATGTGAGGG - Intergenic
1198108715 X:133484190-133484212 GCCCATCATCTGGGATGTGAAGG - Intergenic