ID: 910891737

View in Genome Browser
Species Human (GRCh38)
Location 1:92026433-92026455
Sequence TGCCTGGCCGCCCATCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2881
Summary {0: 977, 1: 896, 2: 533, 3: 251, 4: 224}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910891737_910891745 8 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891745 1:92026464-92026486 CCTCACTTCCCAGATGGGGTGGG No data
910891737_910891749 15 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891749 1:92026471-92026493 TCCCAGATGGGGTGGGGGCCGGG No data
910891737_910891743 7 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891743 1:92026463-92026485 TCCTCACTTCCCAGATGGGGTGG 0: 697
1: 4115
2: 10358
3: 4229
4: 3475
910891737_910891748 14 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891748 1:92026470-92026492 TTCCCAGATGGGGTGGGGGCCGG No data
910891737_910891741 3 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891741 1:92026459-92026481 ACGCTCCTCACTTCCCAGATGGG 0: 462
1: 2987
2: 5658
3: 4727
4: 7843
910891737_910891747 10 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891747 1:92026466-92026488 TCACTTCCCAGATGGGGTGGGGG 0: 143
1: 1502
2: 3062
3: 3898
4: 2022
910891737_910891742 4 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891742 1:92026460-92026482 CGCTCCTCACTTCCCAGATGGGG 0: 516
1: 2852
2: 4749
3: 9803
4: 5601
910891737_910891746 9 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891737_910891752 21 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891752 1:92026477-92026499 ATGGGGTGGGGGCCGGGCAGAGG No data
910891737_910891740 2 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891740 1:92026458-92026480 GACGCTCCTCACTTCCCAGATGG 0: 2075
1: 3551
2: 4573
3: 7634
4: 4758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910891737 Original CRISPR TGCCTGGCCGCCCATCGTCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr