ID: 910891739

View in Genome Browser
Species Human (GRCh38)
Location 1:92026449-92026471
Sequence AAGTGAGGAGCGTCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27124
Summary {0: 3009, 1: 4104, 2: 7826, 3: 9138, 4: 3047}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910891739_910891755 25 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891755 1:92026497-92026519 AGGCTGCAATCTTGGCACTTTGG 0: 91
1: 1150
2: 598
3: 437
4: 5247
910891739_910891748 -2 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891748 1:92026470-92026492 TTCCCAGATGGGGTGGGGGCCGG No data
910891739_910891757 29 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891757 1:92026501-92026523 TGCAATCTTGGCACTTTGGGAGG 0: 89
1: 1337
2: 4569
3: 53645
4: 347482
910891739_910891745 -8 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891745 1:92026464-92026486 CCTCACTTCCCAGATGGGGTGGG No data
910891739_910891756 26 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891756 1:92026498-92026520 GGCTGCAATCTTGGCACTTTGGG 0: 93
1: 1145
2: 762
3: 3470
4: 44154
910891739_910891752 5 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891752 1:92026477-92026499 ATGGGGTGGGGGCCGGGCAGAGG No data
910891739_910891747 -6 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891747 1:92026466-92026488 TCACTTCCCAGATGGGGTGGGGG 0: 143
1: 1502
2: 3062
3: 3898
4: 2022
910891739_910891746 -7 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891739_910891754 17 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891754 1:92026489-92026511 CCGGGCAGAGGCTGCAATCTTGG 0: 1081
1: 492
2: 87
3: 28
4: 176
910891739_910891743 -9 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891743 1:92026463-92026485 TCCTCACTTCCCAGATGGGGTGG 0: 697
1: 4115
2: 10358
3: 4229
4: 3475
910891739_910891749 -1 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891749 1:92026471-92026493 TCCCAGATGGGGTGGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910891739 Original CRISPR AAGTGAGGAGCGTCTCTGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr