ID: 910891746

View in Genome Browser
Species Human (GRCh38)
Location 1:92026465-92026487
Sequence CTCACTTCCCAGATGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910891739_910891746 -7 Left 910891739 1:92026449-92026471 CCAGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891737_910891746 9 Left 910891737 1:92026433-92026455 CCCAGACGATGGGCGGCCAGGCA 0: 977
1: 896
2: 533
3: 251
4: 224
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891731_910891746 19 Left 910891731 1:92026423-92026445 CCCCTCACATCCCAGACGATGGG 0: 6
1: 2
2: 4
3: 25
4: 705
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891734_910891746 17 Left 910891734 1:92026425-92026447 CCTCACATCCCAGACGATGGGCG 0: 1000
1: 1894
2: 1018
3: 363
4: 287
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891738_910891746 8 Left 910891738 1:92026434-92026456 CCAGACGATGGGCGGCCAGGCAG 0: 981
1: 887
2: 553
3: 241
4: 230
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data
910891733_910891746 18 Left 910891733 1:92026424-92026446 CCCTCACATCCCAGACGATGGGC 0: 5
1: 3
2: 2
3: 12
4: 121
Right 910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910891746 Original CRISPR CTCACTTCCCAGATGGGGTG GGG Intergenic
No off target data available for this crispr