ID: 910892223

View in Genome Browser
Species Human (GRCh38)
Location 1:92030032-92030054
Sequence GCTCACCCGCTCCCGAGGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910892220_910892223 -3 Left 910892220 1:92030012-92030034 CCTGGCGCGCTGCGGCGCTCGCT 0: 1
1: 0
2: 0
3: 11
4: 102
Right 910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910892223 Original CRISPR GCTCACCCGCTCCCGAGGAA GGG Exonic
900582416 1:3415670-3415692 GCCCACCCAGGCCCGAGGAAGGG + Intronic
901874418 1:12158819-12158841 GCTGCCCCGCTCCCCTGGAATGG - Intergenic
902044854 1:13516572-13516594 ACTCACCCCCTCTCCAGGAAGGG + Intergenic
905390819 1:37634502-37634524 GCGCCCCAGCTCCCGGGGAAGGG + Intronic
910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG + Exonic
923821580 1:237449083-237449105 GCTCTCACGCTCCCGTGTAAGGG - Intronic
1067493995 10:46746017-46746039 TCTCACTAGCTCCCTAGGAAAGG - Intergenic
1067600667 10:47594387-47594409 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1069659893 10:70116761-70116783 GCTCACCCGCTCACCTAGAAGGG + Exonic
1071652200 10:87402259-87402281 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1080940563 11:36913454-36913476 GCTCCCCCACCCCCGAGAAAAGG + Intergenic
1083297590 11:61723359-61723381 GCTCACCCGCTCTGAAGAAAGGG - Intronic
1084653737 11:70503458-70503480 GCTCTCCCGCTCCAGAGGCCTGG + Intronic
1086279810 11:85172138-85172160 ACTCACCCAGTCCGGAGGAAGGG - Intronic
1091558813 12:1594846-1594868 GCTCCCCCGCGCCCGCGCAATGG + Intronic
1092651700 12:10641824-10641846 GCTGACCCACTCCCTAGGGAGGG - Intronic
1093118758 12:15242851-15242873 GCTCTTTCGCTCCCGATGAATGG - Intronic
1098893139 12:76030476-76030498 GCACTCGCGCTCCCGAGGAGTGG - Intronic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1102300326 12:111766826-111766848 GCGCGCCCCATCCCGAGGAATGG + Intronic
1102490925 12:113289072-113289094 GCTCACCCTCTGCCGAGGGCTGG + Intronic
1107508724 13:41060954-41060976 GCCCACACGCTCCCGAGCTAGGG + Intronic
1121087807 14:91159985-91160007 ACTCTGCAGCTCCCGAGGAATGG + Intronic
1125606272 15:40941628-40941650 GCGCATCCCCGCCCGAGGAAGGG - Intergenic
1131678647 15:94698647-94698669 GCTGAGCAGCTCCCAAGGAAGGG + Intergenic
1132301531 15:100779137-100779159 GCTCGCCCTCTCCCGAGTCAGGG + Intergenic
1136546561 16:30958108-30958130 ACTCACCCGCTCCCGGCGAGCGG - Intronic
1141193090 16:81838888-81838910 GGTCACCGGGACCCGAGGAATGG - Intronic
1144675426 17:17158617-17158639 GCCCACCCGCTCCTGAGCCAGGG - Exonic
1147193480 17:38749957-38749979 GTTCACCGGCCCCGGAGGAAAGG + Exonic
1149350509 17:55782156-55782178 GCTGACCCTCTTCTGAGGAAGGG - Intronic
1151662212 17:75525187-75525209 CCGCACCCCCCCCCGAGGAAAGG + Intronic
1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG + Intergenic
1166788376 19:45382948-45382970 GGCCACCCACTCCCGAGGCAGGG + Intronic
1167436252 19:49480460-49480482 GCTCACCTGCTCCCCAGGGCGGG - Exonic
1167643755 19:50695201-50695223 GCGCACCCCCTCCCGCGGGAGGG + Intronic
1168293851 19:55369590-55369612 GCTCTCCCGCTCCCGCGGCCCGG - Intronic
933390676 2:81662904-81662926 GCTGCCCCGCCCCCAAGGAAAGG + Intergenic
935492126 2:103734022-103734044 GCCCAGCAGCTCCTGAGGAAAGG - Intergenic
938336982 2:130509429-130509451 GCCCACGCCCACCCGAGGAAGGG + Exonic
938352859 2:130611317-130611339 GCCCACGCCCACCCGAGGAAGGG - Intergenic
939432603 2:142130524-142130546 GGTCACCCGGTCCCGGGGAGCGG + Intronic
1170963628 20:21047456-21047478 GCACAGCAGCTCCCTAGGAATGG - Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172032614 20:31992491-31992513 GCTCACACGCTGCCCAGGACAGG - Intronic
1179720525 21:43313801-43313823 GCTCACCTGCTGCCCAGGGAGGG + Intergenic
1182001194 22:26921209-26921231 ACTCACTCACTCCCGAGGGAAGG - Intergenic
1182123578 22:27801311-27801333 GCGCACCCGCTGCCGAGCAGAGG - Exonic
1183373866 22:37450860-37450882 GATTACCCCCTCCCCAGGAAAGG - Intergenic
1184106101 22:42368424-42368446 TTTCTCCAGCTCCCGAGGAAGGG + Intergenic
1185079683 22:48702749-48702771 CCTCACCCGAGCCCGGGGAAAGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
996129599 5:119765816-119765838 GCTCACCCACACCCTATGAATGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1016034901 6:139374889-139374911 GCTCAGCCACCCCCGAGGCAGGG + Intergenic
1023991822 7:45133150-45133172 GCTCACCAGCCCCAGAGGCAAGG + Intergenic
1024569219 7:50710189-50710211 GCCCACCCTCTCCCCAGAAACGG + Intronic
1026830440 7:73607130-73607152 GCTCACCCGACCCCTAGGTAAGG + Intronic
1032442149 7:131950112-131950134 CTTCAGCCGCTCCAGAGGAAAGG + Intergenic
1039880297 8:41621406-41621428 GGCCACCCGCTCTCCAGGAAAGG + Exonic
1042591867 8:70404025-70404047 CCTCTCGCGCCCCCGAGGAAGGG + Intergenic
1048553759 8:135456719-135456741 GCTCATCCGCTCCTGGGGAGAGG - Intergenic
1057670647 9:97084637-97084659 GCTGACCCGCCCCCAAGTAAGGG - Intergenic
1196182248 X:112704674-112704696 GCTCTCCCTCTTCCGAGGACAGG + Intergenic
1199802266 X:151263330-151263352 GCTCACCACATCCAGAGGAAAGG - Intergenic