ID: 910892270

View in Genome Browser
Species Human (GRCh38)
Location 1:92030218-92030240
Sequence GGCCGCCGGAAGGTCTGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910892270_910892283 21 Left 910892270 1:92030218-92030240 CCGGCGCAGACCTTCCGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 910892283 1:92030262-92030284 GTGCCTGAGCGACCCCTCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 135
910892270_910892284 22 Left 910892270 1:92030218-92030240 CCGGCGCAGACCTTCCGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 910892284 1:92030263-92030285 TGCCTGAGCGACCCCTCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910892270 Original CRISPR GGCCGCCGGAAGGTCTGCGC CGG (reversed) Exonic
900014395 1:138260-138282 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900044260 1:493462-493484 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900065668 1:728368-728390 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900124050 1:1061796-1061818 GGCCGGAGCAAGGTCTGCCCAGG + Intergenic
900159736 1:1217863-1217885 GGGCCCCGGAAGGCCTGCCCGGG + Intronic
900182443 1:1317711-1317733 GGCAGCCGTAGGGTCTGAGCAGG - Intronic
900527253 1:3135278-3135300 GGCCTCAGGGAGGTCTGCGGTGG + Intronic
902693589 1:18125878-18125900 GGCAGCCCCAAGGCCTGCGCAGG - Intronic
905119027 1:35667489-35667511 GGCTGCCTGAAGGTCAGTGCTGG + Intergenic
906120080 1:43383733-43383755 GGCAGCTGGAAGGTATGAGCAGG + Intergenic
910892270 1:92030218-92030240 GGCCGCCGGAAGGTCTGCGCCGG - Exonic
911615553 1:100006654-100006676 GGCCCCTGGATGGTCTGCGCAGG + Intronic
913596228 1:120379882-120379904 AGCCCCCGGAAGGTCTTAGCTGG - Intergenic
914091047 1:144499091-144499113 AGCCCCCGGAAGGTCTTAGCTGG + Intergenic
914307556 1:146435114-146435136 AGCCCCCGGAAGGTCTTAGCTGG - Intergenic
914594552 1:149138024-149138046 AGCCCCCGGAAGGTCTTAGCTGG + Intergenic
922262068 1:223951755-223951777 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
922734200 1:227970823-227970845 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
923500511 1:234560101-234560123 GGCCGCCAGCTGGTCTGTGCTGG - Intergenic
924173581 1:241366447-241366469 GGACCCAGGAAGATCTGCGCAGG + Intergenic
924343713 1:243055834-243055856 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
924382068 1:243474484-243474506 AGCCGCCGGGAGGTCTGGGTGGG + Intronic
1063565245 10:7167584-7167606 GGCCTCCGGTAGGTCACCGCAGG - Intronic
1076260401 10:129060376-129060398 GGCCACAGGAAGGTGGGCGCGGG + Intergenic
1076503734 10:130957663-130957685 GGCCACCCGAATGTCTGGGCAGG - Intergenic
1076970592 11:129937-129959 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1082795719 11:57376593-57376615 GGCGGCCGGAAGGCCTCCCCGGG - Intergenic
1092462222 12:8697407-8697429 GGCCGGCGGAAGGGCTGGGCGGG + Intronic
1102063330 12:109952064-109952086 GGCTTCCGGGAAGTCTGCGCAGG + Intronic
1105000684 12:132687932-132687954 CGCCGCGGGAAGTTCAGCGCCGG - Intronic
1108707362 13:53001773-53001795 GGCAGCTGGAAGGTCTGGGGAGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1140481839 16:75266268-75266290 GGCCGGCGGAAGGTGATCGCGGG + Intronic
1141830593 16:86508220-86508242 GGCCAGCGGAAGGGCAGCGCGGG + Intergenic
1142449656 16:90167545-90167567 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1142457432 17:64300-64322 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1142676471 17:1516562-1516584 GGCCGCCCGCAGGGCTGCTCTGG - Exonic
1147311367 17:39597861-39597883 GGCCGCTGAAATGTCTGGGCAGG - Intergenic
1151821940 17:76501342-76501364 GGCCGCAGGGAGGTGAGCGCGGG - Exonic
1151823848 17:76512680-76512702 GGCCATCGGAAGGTTTGAGCAGG + Intergenic
1152272347 17:79332061-79332083 GGCTCCCGGCAGGTCTGCTCTGG + Intronic
1152414107 17:80147677-80147699 GGGCTCCGGCGGGTCTGCGCTGG + Intergenic
1152685756 17:81693211-81693233 TGCCGTAGGAAGGTCTTCGCAGG + Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1153947840 18:10032615-10032637 GGAGCCCGGAAGGCCTGCGCAGG + Intergenic
1159511360 18:69401164-69401186 GTCCGCCGCCGGGTCTGCGCGGG - Exonic
1164897687 19:31891340-31891362 AGCCCCTGGAAGGTCTGGGCTGG - Intergenic
1166039139 19:40191640-40191662 GGCCGCCGGTGGAGCTGCGCGGG + Intergenic
925266912 2:2571966-2571988 GGCCGCTGCAAGGCCCGCGCTGG + Intergenic
929366622 2:41166040-41166062 GGCTGCTGGAAGGTCTCCACTGG - Intergenic
935619108 2:105113260-105113282 GGAAGCCAGAAGGTCTGCGGGGG + Intergenic
941384560 2:164838135-164838157 GGCTGCCGTAGGGTCTGTGCTGG - Intronic
942505544 2:176637954-176637976 GGCCGGCGTCCGGTCTGCGCGGG - Intergenic
946026816 2:216676864-216676886 GGCCACGGGAAGGTTTGCACTGG + Exonic
948732895 2:239978368-239978390 GGCCGCAGGAAGGTCAGGGGTGG - Intronic
1171012790 20:21517609-21517631 GGACGCCGGGAGGCCTGCGCAGG + Intergenic
1175266200 20:57704899-57704921 GGCCGTCGGGAGGTCTGTGGAGG - Intronic
1176207221 20:63895508-63895530 GGGCGCGGGAAGGTCGGCGCCGG + Intronic
1176511120 21:7748895-7748917 GGCAGCTGGAAGGTCTGATCTGG - Exonic
1178645234 21:34379424-34379446 GGCAGCTGGAAGGTCTGATCTGG - Exonic
1180609162 22:17084811-17084833 GGACGCCGGAAGGACTGGGTAGG + Intergenic
1180797148 22:18611508-18611530 GGGCGCCGGAAGGGGCGCGCCGG - Exonic
1181224575 22:21383763-21383785 GGGCGCCGGAAGGGGCGCGCCGG + Exonic
1181254057 22:21551050-21551072 GGGCGCCGGAAGGGGCGCGCCGG - Exonic
1184415544 22:44349946-44349968 GGCTGCAGGCAGGTCTGAGCTGG + Intergenic
951381979 3:21995479-21995501 GGCCCCCTGAAGGTATGCACAGG + Intronic
952316915 3:32239200-32239222 GCCCGCGGGAAGATCTGAGCAGG - Intronic
953484937 3:43286471-43286493 GGCCGCGGGAAGGGCAGGGCGGG - Intergenic
953614450 3:44477646-44477668 AGCCGCCGGGAGGTAGGCGCGGG - Intronic
954397902 3:50302751-50302773 GGGCCGCGGAAGGTCTGCCCTGG + Exonic
961009413 3:123425789-123425811 GGCTCCTGGAAGGTCTGTGCTGG + Intronic
968579694 4:1384122-1384144 GGCAGCAGGCAGGTCTGCTCAGG + Intronic
969219612 4:5751433-5751455 GGCCGCGGGAAGGGCGGCTCTGG - Intronic
979259362 4:118633723-118633745 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
979259537 4:118634386-118634408 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
991626811 5:68611127-68611149 GGCCCCCAGAAGGTATGTGCTGG - Intergenic
998383650 5:141743457-141743479 GGCCGCCGGCAGGTGTCTGCTGG + Intergenic
998463938 5:142328066-142328088 GGTGGCCGGTAGGTCTGTGCTGG + Intergenic
1001381487 5:171309339-171309361 GGCGGGCGGAAGGGCTGGGCTGG - Exonic
1002448036 5:179302045-179302067 GGCTGGCGGAAGGGCTGTGCTGG - Intronic
1002729583 5:181325467-181325489 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1006228349 6:32559946-32559968 GGCCGCCAGAAGGTTTGCTGAGG - Intronic
1006319709 6:33313333-33313355 GCCCGCGGGCAGTTCTGCGCGGG + Exonic
1007390812 6:41548554-41548576 AGCTGCGGGAAGGTCTGTGCCGG + Intronic
1018244115 6:161805593-161805615 GGCCATCGGAGGGCCTGCGCTGG - Intronic
1018864286 6:167735190-167735212 GGTCGGCGGAAGGTCAGCGGGGG - Intergenic
1024074272 7:45810769-45810791 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024649062 7:51389429-51389451 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025042720 7:55662240-55662262 GGCCTCCTGAAGGTGTGCACAGG - Intergenic
1025053140 7:55744759-55744781 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025178354 7:56813013-56813035 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179222 7:56816545-56816567 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179544 7:56817911-56817933 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025179679 7:56818431-56818453 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179994 7:56819749-56819771 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180128 7:56820269-56820291 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180467 7:56821731-56821753 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180599 7:56822251-56822273 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025181473 7:56825840-56825862 GGCCGCCGGGAGGCATGAGCTGG + Intronic
1025182061 7:56828304-56828326 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025689866 7:63748691-63748713 GGCCGCCGGGAGGTATGAGCTGG - Intergenic
1025690440 7:63751140-63751162 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025690888 7:63752963-63752985 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691328 7:63754738-63754760 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691767 7:63756562-63756584 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692214 7:63758385-63758407 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692660 7:63760208-63760230 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693076 7:63761887-63761909 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693522 7:63763710-63763732 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025694179 7:63766379-63766401 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
1032051304 7:128652588-128652610 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1033657142 7:143381768-143381790 CGCCCCCGGAAGGTATGCGGCGG + Exonic
1050091334 9:2017808-2017830 AGCCGGCGGCAGGGCTGCGCAGG - Intronic
1057806143 9:98221148-98221170 AGCCGCCGCCAGGTATGCGCTGG + Exonic
1060797405 9:126522090-126522112 GGCCTCAGGAAGGGCTGGGCAGG + Intergenic
1062263887 9:135678024-135678046 GGCCGCCGGATGGAGTGGGCAGG - Intergenic
1062519719 9:136952599-136952621 GGTGCCAGGAAGGTCTGCGCTGG - Intronic