ID: 910895682

View in Genome Browser
Species Human (GRCh38)
Location 1:92066912-92066934
Sequence CGTCTAGTCACTTTTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910895677_910895682 22 Left 910895677 1:92066867-92066889 CCACAGATTCTGATTTTCCTAGA 0: 1
1: 0
2: 2
3: 40
4: 304
Right 910895682 1:92066912-92066934 CGTCTAGTCACTTTTAAACCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
910895679_910895682 5 Left 910895679 1:92066884-92066906 CCTAGAAGGTGTGTGCATCAATC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 910895682 1:92066912-92066934 CGTCTAGTCACTTTTAAACCAGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910895682 Original CRISPR CGTCTAGTCACTTTTAAACC AGG Intergenic
905586866 1:39126833-39126855 GGTTTAGTCACTTTGTAACCTGG + Intronic
910895682 1:92066912-92066934 CGTCTAGTCACTTTTAAACCAGG + Intergenic
914339040 1:146742662-146742684 TTACTAGTCACTTTCAAACCTGG - Intergenic
1080866075 11:36196277-36196299 CTTCTAGTCATTTTTAAATGTGG - Intronic
1082892705 11:58157221-58157243 CGTCTACTCACTTTCCTACCAGG + Intronic
1083295801 11:61715028-61715050 AGTCTCCTCACTTCTAAACCAGG - Intronic
1087500804 11:98951318-98951340 CATCCAGTCACTTGCAAACCAGG - Intergenic
1092869967 12:12797615-12797637 AGTCTAGTGACTTTCAAAACAGG + Intronic
1093458072 12:19383988-19384010 GGTCTAGTCACTTTGAGAACTGG + Intergenic
1099073804 12:78080092-78080114 CATCTAGACATTCTTAAACCTGG + Intronic
1099509556 12:83517439-83517461 CTTCTTGTCAGTTTTAATCCTGG + Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1105272657 13:18892643-18892665 CGTCTAGCCACCTTTAAACTAGG + Intergenic
1124176074 15:27425283-27425305 CTTCTAGTGAATTGTAAACCTGG + Intronic
1128753320 15:70164231-70164253 ATTTTAGTCACTTTTAACCCAGG + Intergenic
1130327930 15:82896377-82896399 TGTCTACTCACTTTGACACCTGG - Intronic
1132786485 16:1659686-1659708 CGACCAGTAACTTTTAAAACTGG + Intronic
1139995240 16:70974690-70974712 TTACTAGTCACTTTCAAACCTGG + Intronic
1159716631 18:71832117-71832139 AGTCTAGTTGGTTTTAAACCTGG - Intergenic
939237178 2:139510418-139510440 TGTCTAGTCGCTTTTAAGGCTGG + Intergenic
940878294 2:158920919-158920941 CTTCTAGTCACTGTTACTCCAGG + Intergenic
941702857 2:168623351-168623373 AATCTAGTTAGTTTTAAACCTGG - Intronic
944939852 2:204611930-204611952 AGCCTATTGACTTTTAAACCAGG + Intronic
1169263003 20:4151132-4151154 CATCTACTCACTTTTAAAGATGG + Intronic
1179138680 21:38702915-38702937 GGTCTGGTCACTTTTAAAAAGGG + Intergenic
952938160 3:38417507-38417529 CATTTAGTCCCTTTTAATCCAGG - Intronic
974387750 4:61225039-61225061 GGTCTTCTCACTTCTAAACCAGG + Intronic
994283679 5:97938147-97938169 CTTTTAGTCACAGTTAAACCTGG - Intergenic
1013853434 6:114542444-114542466 GGTCTAGTCACTTTGCTACCTGG + Intergenic
1018217131 6:161539376-161539398 CGGCTGGCCACTCTTAAACCTGG - Intronic
1023145707 7:37148839-37148861 CCTCTCGTCACTTTAAAACAAGG + Intronic
1027437373 7:78178291-78178313 CGGCTAGTCACTATTATTCCAGG - Intronic
1031327432 7:120419178-120419200 CCACAAGTCATTTTTAAACCTGG + Intronic
1037284195 8:17279299-17279321 CCTCTAGTCAGCTTTAGACCAGG - Intronic
1037681014 8:21097466-21097488 AGTCTCTTCACTTTTAAAACAGG - Intergenic
1050398715 9:5228433-5228455 CGACTAGTGATGTTTAAACCAGG - Intergenic
1052242136 9:26286656-26286678 CATCTAGTCAGTTTAACACCTGG + Intergenic
1187858400 X:23658822-23658844 CGTCCACACACTTTTAAGCCTGG - Intergenic
1187900990 X:24026080-24026102 GATCTAGTCACTTTTATAACAGG - Intronic