ID: 910896480

View in Genome Browser
Species Human (GRCh38)
Location 1:92075332-92075354
Sequence GTCTCCTCCAGTCCCAGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 4, 2: 5, 3: 29, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910896475_910896480 7 Left 910896475 1:92075302-92075324 CCCTTCTTCGGCAAGCCTGCAGA 0: 3
1: 2
2: 3
3: 22
4: 108
Right 910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG 0: 1
1: 4
2: 5
3: 29
4: 307
910896478_910896480 -8 Left 910896478 1:92075317-92075339 CCTGCAGAGGCCGATGTCTCCTC 0: 3
1: 2
2: 3
3: 6
4: 128
Right 910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG 0: 1
1: 4
2: 5
3: 29
4: 307
910896476_910896480 6 Left 910896476 1:92075303-92075325 CCTTCTTCGGCAAGCCTGCAGAG 0: 3
1: 2
2: 3
3: 9
4: 135
Right 910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG 0: 1
1: 4
2: 5
3: 29
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910896480 Original CRISPR GTCTCCTCCAGTCCCAGAGC AGG Exonic
901208097 1:7508789-7508811 CTCTCCTCCAGGGCCAGGGCTGG - Intronic
901312226 1:8278232-8278254 CTTTCCTCCAGACCCAGAACTGG + Intergenic
902544564 1:17181904-17181926 GTCTCCTCCAGAAACAGAGGTGG - Intergenic
902799557 1:18820836-18820858 GTCTCTTCCAGGCCCAAGGCTGG - Intergenic
903002756 1:20277957-20277979 GTTTCCTCCAATTCCATAGCCGG + Intergenic
903217494 1:21851527-21851549 CTGTCCTCCAGTCCCATACCTGG + Exonic
903331110 1:22597658-22597680 GTCTCCTGCAGGCCCCGAGAGGG - Exonic
903514651 1:23902348-23902370 GCGTCCTGCTGTCCCAGAGCCGG - Intronic
903928730 1:26850021-26850043 GTCTCTTCCAATCCCAGACTAGG - Intronic
903995933 1:27305618-27305640 GTCCCCTCCACTCCCAGGGTGGG + Intronic
904039562 1:27575964-27575986 GGCGCCTCCAGTCCCCGGGCCGG - Intronic
904705114 1:32384127-32384149 CTCTCCTGCAGCCCCAGAGACGG - Intronic
904836892 1:33343728-33343750 GCCTCTTACAGCCCCAGAGCAGG + Intronic
909722662 1:78794702-78794724 GTCTTCTCCAGTCCTGGAGATGG + Intergenic
910646918 1:89524598-89524620 GGCTCCCGCAGCCCCAGAGCTGG + Intergenic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
911238766 1:95441350-95441372 CTCTCCTCTAATCCCAGAGAGGG + Intergenic
912645362 1:111387001-111387023 GTCTCCTCCTGTGCCTCAGCAGG - Intergenic
916001362 1:160619495-160619517 GACTCCTACAATGCCAGAGCTGG + Intronic
916694107 1:167220126-167220148 GTCTCCTGCACTAGCAGAGCCGG + Intergenic
916864116 1:168837406-168837428 GTCTCCTCAATTCCCAGACGGGG - Intergenic
917098028 1:171418969-171418991 GTCACCTCCATTCCCAGCCCTGG - Intergenic
917864798 1:179183898-179183920 GTCTCTTCCAGTCTCAGAACAGG - Intronic
919179977 1:194068180-194068202 GTCACCTCCAGTCCCAGTCAAGG + Intergenic
920179587 1:204124244-204124266 GGCTCCTCCAGTGTCAGCGCAGG + Intronic
920399252 1:205666958-205666980 GTCTCCTGAAAACCCAGAGCAGG - Intronic
922162167 1:223086133-223086155 GTCTCCTCTAGCCCCACAGTTGG + Intergenic
922626781 1:227054493-227054515 GCTTTCTCTAGTCCCAGAGCTGG + Intronic
922721611 1:227902826-227902848 CTCTCCTCCAGTCCCACTGTGGG + Intergenic
1063036750 10:2293849-2293871 GTAGCTTCCTGTCCCAGAGCTGG - Intergenic
1063133798 10:3199477-3199499 GTCTCCTCCACTGTCAGGGCAGG + Intergenic
1064028725 10:11869758-11869780 GTGTCCTCCACTCCCCGGGCCGG - Exonic
1067053127 10:43036735-43036757 TTCTCCAGCTGTCCCAGAGCGGG - Intergenic
1069540575 10:69291023-69291045 GGCTCCTTCTTTCCCAGAGCAGG - Intronic
1069568244 10:69478103-69478125 AGCTTCTCCTGTCCCAGAGCAGG - Intronic
1069922080 10:71821883-71821905 GGCTCCACCAGTTCCAGGGCAGG + Exonic
1070665852 10:78342920-78342942 AGCTCCTACAGGCCCAGAGCTGG + Intergenic
1070682241 10:78456740-78456762 GCGTGCTCCAGTCCCACAGCTGG - Intergenic
1070788507 10:79176073-79176095 GTGTCCTCCAGCCCCAGCCCAGG - Intronic
1071294779 10:84211691-84211713 GTCTGCCCCAGTCCCATAGGTGG - Exonic
1072199909 10:93149160-93149182 GTCTCCTCCCATCCCAGAGTGGG + Intergenic
1074061384 10:109969268-109969290 GTGTGCTCCAGTCTCAGAGCAGG + Intergenic
1075887455 10:125913706-125913728 CTTGCCCCCAGTCCCAGAGCTGG - Intronic
1076724765 10:132408144-132408166 GGCACCCCCACTCCCAGAGCAGG - Intronic
1077037859 11:503932-503954 GACTTCTCCAGTCACAGAGAAGG - Intronic
1077141711 11:1027700-1027722 TGCTTCTCCAGCCCCAGAGCAGG + Exonic
1077162903 11:1121729-1121751 GTGTCCTCCACTCCCAGGCCAGG + Intergenic
1077322624 11:1949126-1949148 CACTCCTGCAGTCCCACAGCTGG + Intronic
1077551542 11:3202667-3202689 GTCTCCTACACACCCTGAGCTGG - Intergenic
1078025480 11:7691268-7691290 GTCTCCTTCATTCCTAAAGCAGG - Exonic
1078084401 11:8225045-8225067 GCCTACCCCAGTCCCAGAGAGGG + Intronic
1078147143 11:8729949-8729971 GTCACCGCAAGTCCCAGAGCAGG - Exonic
1078191585 11:9095815-9095837 GCCTCCACCAGTGCCAAAGCTGG - Intronic
1079401904 11:20112620-20112642 GACTCAGCCAGACCCAGAGCAGG - Intronic
1081891438 11:46545653-46545675 GTCGACTCCAGTCCCAGAAGTGG + Exonic
1082121254 11:48382564-48382586 GTTGCCTCCAGCCCCAAAGCTGG + Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083582362 11:63833019-63833041 ATCTCCTCCAGCCCCACATCTGG + Intergenic
1083618569 11:64037950-64037972 GAATCCTCCAGTCCAGGAGCAGG - Intronic
1084593699 11:70105014-70105036 CTCTCCTCCAGATCCAGAACAGG + Intronic
1084785335 11:71438666-71438688 GCCTCCTCCCCTCCCAGGGCTGG + Intronic
1084980746 11:72827276-72827298 GTCACCTGCTGTCCCAGAACCGG - Exonic
1085159600 11:74328264-74328286 GTCTCCTCACATCCCAGAGACGG - Intergenic
1088923544 11:114279374-114279396 GTCTTCTCCAGTTCCCCAGCAGG - Intronic
1089399434 11:118156006-118156028 GTCTCCTGCAGCCTGAGAGCGGG - Intergenic
1089595643 11:119577926-119577948 TCCTTCTCCAGTCCCAGAGGCGG - Intergenic
1090229087 11:125088953-125088975 GTCTACTCCATTCCTAGAGCTGG - Exonic
1090660068 11:128875765-128875787 GGCTCCTGCATTCCAAGAGCTGG - Intergenic
1091330550 11:134728220-134728242 ATCTCCACCAGGCCCAGGGCGGG - Intergenic
1202805641 11_KI270721v1_random:4439-4461 CACTCCTGCAGTCCCACAGCTGG + Intergenic
1091750777 12:3020173-3020195 GTCTCCCCCGCTCCCAGAACAGG - Intronic
1091763574 12:3103831-3103853 CACTCCTGCAGCCCCAGAGCCGG - Intronic
1091776089 12:3185785-3185807 GTTTCTTCTAGGCCCAGAGCTGG + Intronic
1092142795 12:6195426-6195448 GTCCCTTCCTGGCCCAGAGCAGG - Intergenic
1095465344 12:42483459-42483481 GCCTCCTTCAGACGCAGAGCGGG - Intronic
1095476414 12:42590620-42590642 GTCTGCTCAATTCCCAGAGCTGG + Intergenic
1095955278 12:47802443-47802465 GACTCCTCCAGTCCCCCTGCTGG + Intronic
1095965469 12:47864357-47864379 GTCTTCTCCAACCCCAGAGAGGG + Intronic
1096797464 12:54086854-54086876 GCCTCCTCCAGCACCAGAGAGGG + Intergenic
1101491256 12:105211792-105211814 GTCACTTCCAGGCCCATAGCTGG - Intronic
1102328608 12:112011025-112011047 GCCTGCTCCAATCTCAGAGCGGG - Intronic
1102650868 12:114441514-114441536 GCCTACTCCAGGCCCAGAGAGGG + Intergenic
1104445944 12:128833635-128833657 GACCCCTCCAGTCCAAGAGTGGG + Intergenic
1106019378 13:25900000-25900022 TTCTACTCCAGTCCCTGGGCAGG - Intronic
1108673118 13:52711612-52711634 GTCTCATTCTGTCCCAAAGCTGG - Intronic
1108699954 13:52935209-52935231 CTCACCTCCACTCCCAGTGCTGG + Intergenic
1110810573 13:79807561-79807583 GCCTGCTCCAATCTCAGAGCAGG + Intergenic
1112545046 13:100359819-100359841 TTCTCTTCCAGTCCATGAGCAGG - Intronic
1113523019 13:110953922-110953944 GCCTCGTCCACTCCCAGGGCAGG - Intergenic
1113780878 13:112976696-112976718 CTCTCCTTCAGTCCCAGCCCGGG - Intronic
1114201877 14:20528881-20528903 GTCTCCTCCAGTCTCAGAGCAGG + Intergenic
1118770913 14:68942130-68942152 GTCTGCTCCAGTCCCACCCCGGG - Intronic
1119318761 14:73717306-73717328 TTCACTTCCAGTCCCATAGCGGG - Exonic
1122112766 14:99513645-99513667 GTCTCATGCAGGCCCAGGGCTGG - Exonic
1122971486 14:105154051-105154073 TTCCCGGCCAGTCCCAGAGCGGG - Intronic
1122993472 14:105249780-105249802 GCGTCCTGCTGTCCCAGAGCCGG + Exonic
1123062006 14:105598639-105598661 TGCTGCTCCAGGCCCAGAGCTGG + Intergenic
1123086749 14:105720370-105720392 TGCTGCTCCAGGCCCAGAGCTGG + Intergenic
1202870678 14_GL000225v1_random:160378-160400 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic
1124005792 15:25794517-25794539 GTCCCCTCTATTCCCAGGGCTGG - Intronic
1124023517 15:25944587-25944609 GCCTCCGCCAGCCCCAGAGAGGG + Intergenic
1126087401 15:45023066-45023088 GCCTCCTCCAGACCCGGAGGCGG - Intergenic
1126189617 15:45866082-45866104 GTCTACTTCAGTCTCAGAGCTGG + Intergenic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128481731 15:68045761-68045783 GCCTGCTCCAATCTCAGAGCAGG + Intergenic
1128733125 15:70034262-70034284 CTCTGCACCATTCCCAGAGCAGG - Intergenic
1129002379 15:72345539-72345561 TTTTCCTCCAGGCCCAGAGCAGG - Exonic
1129674781 15:77626667-77626689 GTCTACTGCAGGCCCAGAGAGGG + Intronic
1130869251 15:87957338-87957360 GACGCCTACAGTCCCACAGCGGG + Intronic
1131174932 15:90203477-90203499 GTCCCATCCAGTTCCAGAGTTGG - Intronic
1131670933 15:94618911-94618933 CTCTCCTTCACCCCCAGAGCAGG - Intergenic
1132220119 15:100099083-100099105 GTTTCCTCCAGCCCCAAAGAAGG + Intronic
1132555858 16:572388-572410 GGATCCTCCAGCCCCAGTGCGGG + Intronic
1132808389 16:1786343-1786365 GTCCCCTGCAGCCCCAGACCCGG - Intronic
1132913622 16:2329556-2329578 GTCCTCTCCAGTCCCAGGGCTGG + Intronic
1133050027 16:3112443-3112465 GTCACCTCCCGGCCAAGAGCAGG + Intergenic
1133287219 16:4696203-4696225 GTCTCCTACAGCCCCACATCTGG + Intergenic
1135080068 16:19426581-19426603 GTCTCCATCTGTCCCAGAGACGG + Intronic
1136105023 16:28024241-28024263 ATCTCTGCCAGCCCCAGAGCTGG - Intronic
1140275311 16:73503540-73503562 TTCTCCTCCAGTTCCTGACCTGG + Intergenic
1140665355 16:77222438-77222460 GCCTCCTTCAGTCTCAGAGTGGG - Intergenic
1140859447 16:79006261-79006283 TTCTCCTCCATTCCCAGGACAGG - Intronic
1141531647 16:84650143-84650165 GCATCCTCCAGTCACAGTGCTGG + Intronic
1141703674 16:85653499-85653521 GTCTTCTCCAGGCACAAAGCAGG - Intronic
1142232289 16:88905591-88905613 CTCTCCTCCAGCCCCTAAGCGGG - Intronic
1143767685 17:9148393-9148415 GTCTCCACAAGTCCCAGAAGAGG - Intronic
1143775418 17:9195794-9195816 CCCCCCTCCAGCCCCAGAGCAGG + Intronic
1145236639 17:21213549-21213571 GTCTCTTCCGAGCCCAGAGCCGG - Intronic
1145918481 17:28591763-28591785 GGCTCTTCCAGTCCCGAAGCTGG + Exonic
1147658349 17:42103793-42103815 GTCTCCTCCCACCCCAGATCCGG - Exonic
1147953019 17:44117517-44117539 GCTTCCTGCAGGCCCAGAGCCGG - Exonic
1148227259 17:45907490-45907512 TCCTTCTCCAGTCACAGAGCTGG + Intronic
1148229293 17:45921295-45921317 CTCTTCTCCAGACCCAGACCTGG + Intronic
1149339940 17:55675046-55675068 TCCTCCTCCAGTCCCACAGTGGG + Intergenic
1151326708 17:73384084-73384106 GCCTCCTGCAGCCACAGAGCAGG + Intronic
1151360281 17:73584519-73584541 GCCTCCTACAGTCGGAGAGCAGG - Intronic
1151573185 17:74937447-74937469 CTCTCCTCCAGCCCCCAAGCAGG - Intronic
1151679343 17:75615387-75615409 CCCTCCTCCAGTCCCAGAGCTGG - Intergenic
1152206306 17:78976436-78976458 GCCACCTCCACTCCCAGTGCTGG - Intronic
1152374976 17:79914307-79914329 GTCACCTCCACTGCCAGAGAGGG - Intergenic
1153116429 18:1662540-1662562 GTCTCAAGCAGTCCTAGAGCTGG - Intergenic
1155199407 18:23503823-23503845 GTCCCGTCCCGTCCCAGCGCGGG + Intronic
1155651686 18:28151094-28151116 GTCTCCTGCAGTCTCATACCTGG - Intronic
1157199358 18:45646044-45646066 TTCTCCAGCAGCCCCAGAGCAGG - Intronic
1158098581 18:53804045-53804067 GTAAGCTCCAGTCCCAAAGCTGG - Intergenic
1160106134 18:75978448-75978470 TTCTCCTCCCTCCCCAGAGCTGG + Intergenic
1160391709 18:78539109-78539131 CTCTCCTGGATTCCCAGAGCTGG - Intergenic
1160554659 18:79717524-79717546 GTCTCCTGCAGGCACAGAGAAGG + Exonic
1161458220 19:4380590-4380612 GTTTTTTCCAGTCCAAGAGCTGG - Intronic
1162231572 19:9270971-9270993 GCCTCCTCCAGTCTCGGAGAGGG + Intergenic
1162546383 19:11333051-11333073 TTCTCCATCAGCCCCAGAGCTGG - Intronic
1162787660 19:13045769-13045791 TCCTCCTCCAGTGCAAGAGCTGG + Intronic
1163228052 19:15979033-15979055 TTCTCCTCCATTCCCAGCACAGG - Intergenic
1165870756 19:38971290-38971312 GACTCCTCCAATCCCATAGCTGG - Intronic
1166253485 19:41586623-41586645 GTCTCCTCAGGACTCAGAGCTGG - Intronic
1166257888 19:41619214-41619236 GTCTCCTCAGGACTCAGAGCTGG + Exonic
1166410541 19:42553363-42553385 GTCTCCTCAGGACTCAGAGCTGG + Intronic
1167671559 19:50856487-50856509 CTCTCCCCCAGTCCCAAGGCTGG - Intronic
925905090 2:8535417-8535439 GTCTCCTCCGCTCCCAGGCCTGG + Intergenic
925931864 2:8714529-8714551 GTCCCCTCCAGTCTGAAAGCTGG + Intergenic
926133197 2:10318421-10318443 GTCTACTGCAGTCCCGGTGCCGG + Intronic
926845970 2:17139471-17139493 GTCTCCTCTTGTCCCACACCAGG + Intergenic
927391900 2:22605420-22605442 GTCTGCTGCTGTCCCAGAGCCGG - Intergenic
929419061 2:41772424-41772446 CTCTCCACCAGTCTGAGAGCAGG + Intergenic
930583970 2:53247957-53247979 GTCTCCTCCAGCCCTTAAGCTGG - Intergenic
933073533 2:77892911-77892933 GACTCTACCAGTCCTAGAGCTGG + Intergenic
935129792 2:100253217-100253239 GTCTCCTCCTGAGCCAGGGCAGG + Intergenic
935675921 2:105595057-105595079 ATCTAATCCAGCCCCAGAGCTGG + Intergenic
937256958 2:120562390-120562412 GTCTCCTCCACTGACACAGCAGG + Intergenic
937313103 2:120914335-120914357 GTCTCCTCCAGCTCCTGGGCTGG + Intronic
938391830 2:130912670-130912692 AGCTCCCCCAGGCCCAGAGCTGG - Intronic
939590267 2:144055724-144055746 GTCCCCTCGAGTTCCAGAGAAGG + Intronic
940062467 2:149587678-149587700 GTCTCCAGCTGTCCCAGAACCGG + Intronic
942668662 2:178350028-178350050 GGCTGCACCAGTTCCAGAGCTGG - Intronic
944657538 2:201891128-201891150 TTCTCTTCCACTCCCGGAGCAGG + Intronic
944879259 2:203994688-203994710 GCCTCCTCCACTTCCAGAGCAGG - Intergenic
946051659 2:216867807-216867829 GGCTCCTTCTGTCTCAGAGCTGG - Intergenic
946089518 2:217208211-217208233 TTCCCCTCCACTTCCAGAGCGGG - Intergenic
946279911 2:218659364-218659386 CTCACCTCCAGACCCAGAGCCGG + Exonic
946308721 2:218871287-218871309 CTCTCCTCGGGTCCCACAGCAGG - Intronic
946688051 2:222291242-222291264 CTCTGCTCCAGTCTCAGCGCGGG + Intronic
947235380 2:227935998-227936020 CTCTCCTCCAGTCTCAGAACAGG - Intergenic
948687321 2:239677429-239677451 GTCTCCTCAGTTCCCAGGGCTGG + Intergenic
949034394 2:241809991-241810013 GACTCCACCAGTCCCAGACTTGG + Intronic
1170599000 20:17826683-17826705 GTCACCTCAGGTCCAAGAGCAGG + Intergenic
1170766212 20:19291750-19291772 GTCTCCTGCAGGCCCAGGGCTGG - Intronic
1171433789 20:25104056-25104078 GCCTCCTCCTGCCCCAGAGACGG + Intergenic
1172186762 20:33035769-33035791 GCCTCCTCTAGTCCCAAGGCTGG - Intronic
1173203391 20:40970480-40970502 GTCTCGCCCAGTCCGGGAGCAGG + Intergenic
1173580490 20:44143424-44143446 GCCTCCTGCAGCCTCAGAGCAGG - Intronic
1174119500 20:48251998-48252020 AGCGCCTCCAGTCCCAGGGCTGG + Intergenic
1174282178 20:49447244-49447266 TCCTCATCCAGTCCCAGGGCTGG + Intronic
1174291117 20:49509182-49509204 GTTTCCTACAGCCTCAGAGCTGG - Intronic
1175810338 20:61854264-61854286 CTGCCTTCCAGTCCCAGAGCTGG - Intronic
1176665141 21:9679194-9679216 GCCTCCGCCAGCCCCAGAGAAGG + Intergenic
1177978887 21:27885567-27885589 GTCTCGGCCAGCCCCAGAGAAGG + Intergenic
1179623393 21:42633283-42633305 GTCACCTGCAGTCCCAGAGAAGG - Intergenic
1179814667 21:43897678-43897700 GGCTCCTCCCATCCCAGAGGGGG + Intronic
1180010910 21:45050634-45050656 GGCTCCTCCAGTGCAGGAGCTGG + Intergenic
1181581223 22:23829155-23829177 GTCTCCTCCCGTCCCTGGCCAGG - Intronic
1181669443 22:24419338-24419360 GACTGCACCAGGCCCAGAGCAGG + Intronic
1182373903 22:29832083-29832105 GTCTCTTCCAGGCCCAGAGTAGG - Intronic
1182451768 22:30426015-30426037 GCCTCCTCCAGGCCCCGGGCGGG - Intronic
1182621725 22:31622140-31622162 AACTGCTCCAGTCCCAGAACGGG + Intronic
1183695204 22:39417854-39417876 GCCCCCTCCTGTCCCAGGGCAGG + Intronic
1184495986 22:44841808-44841830 GTCTGCTCACGTCCCACAGCAGG + Intronic
1184758708 22:46532922-46532944 TTCACCTCCAGCCCCAGAGCAGG + Intronic
1185053883 22:48567925-48567947 GTGGCCTGCAGTCCTAGAGCTGG + Intronic
1185220778 22:49628108-49628130 GTCCCAGCCGGTCCCAGAGCCGG - Intronic
1185409254 22:50673944-50673966 ATCTCCTCCAGGCCCGAAGCTGG + Intergenic
951040238 3:17981601-17981623 GTCTCCTGCACTCCCAGAGCTGG + Intronic
951264137 3:20547837-20547859 GTCTCCTCACTTCCCAGACCGGG + Intergenic
953927068 3:46987956-46987978 GTCTCCTCCCGCCCCGGGGCTGG - Intronic
955224039 3:57046639-57046661 TTCTCCTACAGTGCTAGAGCAGG + Intronic
955313803 3:57917805-57917827 GGCTTCTCCATTCCCCGAGCTGG - Intronic
955407057 3:58632293-58632315 GCCACCTTCATTCCCAGAGCAGG + Intergenic
955567354 3:60261709-60261731 GTTTCCTCCAGTGCCAAAGTGGG - Intronic
956285737 3:67608173-67608195 GTCTCCTCCAGTCACTCAGAGGG + Intronic
957543945 3:81612762-81612784 GTCTCCTTGGGTCCCACAGCAGG + Intronic
957549904 3:81690434-81690456 GCCTGATCCAGTACCAGAGCTGG - Intronic
958161185 3:89818451-89818473 GTCTCCTCTCCTCCAAGAGCTGG - Intergenic
959011778 3:101085890-101085912 GGCTCCACCAGTCTCTGAGCAGG + Intergenic
961913691 3:130347736-130347758 GTGCCCTCCACTCTCAGAGCTGG - Intronic
961988660 3:131164209-131164231 GTCCCCTTCAAACCCAGAGCTGG - Intronic
963957300 3:151269018-151269040 GTCTCCTCCGGTCTCAGAGCAGG - Intronic
964369741 3:155987361-155987383 GTCTCCTCCGGTCACAGAGCAGG - Intergenic
965434773 3:168636245-168636267 CTCTCCTCCAGTCCTAGACATGG - Intergenic
966912345 3:184566492-184566514 ATCTTCTCCAGTCCCATGGCAGG + Intronic
966931938 3:184681019-184681041 GTCTCCTCCAGTCTCAGGTGAGG + Intronic
967382305 3:188872686-188872708 GTCTCCTCCTGGCCCGGGGCTGG - Exonic
968545375 4:1195252-1195274 ATCTCCTGCGGTCCCAGGGCGGG + Intronic
968757109 4:2422529-2422551 GTCTCCCCCTGTCCTGGAGCTGG - Intronic
969316078 4:6381956-6381978 CTCTCCCCCACTCCCAGGGCTGG - Intronic
969317962 4:6393591-6393613 GGCTCCTGCAGTAGCAGAGCTGG - Intronic
971330217 4:25675833-25675855 GGCTCCTCAAGTCCCACAGGTGG - Intronic
971401993 4:26284825-26284847 GTGTCCTCCATCCCCAGAACAGG + Intronic
972604978 4:40605355-40605377 CTGTGCTCCAGCCCCAGAGCTGG - Intronic
972730303 4:41788230-41788252 CTCTCCCCCACTCCCAGGGCTGG - Intergenic
973133391 4:46676146-46676168 TTCTCCTCTTGTCCCACAGCTGG + Intergenic
973279162 4:48341520-48341542 GCCTCCCCCAATCCCGGAGCCGG + Exonic
975913584 4:79297561-79297583 GCCTGCTCCAATCTCAGAGCAGG + Intronic
976327786 4:83792669-83792691 CTCTGTTCCAGTCCCTGAGCTGG - Intergenic
976478648 4:85513305-85513327 GTCTCCTCCAGTGCCTGAAATGG - Intronic
978407825 4:108398567-108398589 GTCTCCAGCAGCCCCATAGCTGG - Intergenic
978514194 4:109554015-109554037 GTCTCCTCTGGTCTCAGAACAGG + Intergenic
978944787 4:114482101-114482123 GTCTCGGCCAGTCCCAGAGAGGG + Intergenic
978964613 4:114725713-114725735 GTGTGCTCCAATCTCAGAGCAGG - Intergenic
985273992 4:188219786-188219808 GTCTCCTTGAGCCCCAGATCGGG + Intergenic
985410622 4:189679662-189679684 GCCTCCGCCAGCCCCAGAGAAGG + Intergenic
987203924 5:15605187-15605209 CTCTGCTCCAGCCACAGAGCTGG + Intronic
989566444 5:42905942-42905964 GTTTCATCCAGTCTCACAGCAGG - Intergenic
990873598 5:60460660-60460682 GTCTCCTCCGGTCCCAGAGCAGG + Intronic
991120520 5:63008295-63008317 GCCTCAGCCAGTCCCAGAGAGGG - Intergenic
994207958 5:97057182-97057204 GTCTTCTCCGGTCCCAGAGCAGG + Intergenic
994207975 5:97057279-97057301 AGAACCTCCAGTCCCAGAGCAGG + Intergenic
996152597 5:120058186-120058208 GTCTCCTCCACTGTCAGAGGTGG - Intergenic
996567141 5:124892368-124892390 GCCTCATCCAGCCCCAGAGGGGG - Intergenic
999732636 5:154486271-154486293 ATCTCCTCCAGGCTCAGAGAGGG - Intergenic
1001485627 5:172117625-172117647 TTCTCCTCCATTTCCAGAGCTGG - Exonic
1002427646 5:179185594-179185616 GTCACCTCCTGTCCCAAATCAGG - Intronic
1002700279 5:181119222-181119244 CTCACCTGCAGTCACAGAGCAGG + Intergenic
1004583097 6:16973391-16973413 CTGTCTTCCAGTCCCAAAGCAGG + Intergenic
1005352183 6:24947580-24947602 TTCTCCACCAGTCCCAGGTCAGG - Intronic
1006030503 6:31173644-31173666 GTCTCCTCCAGGCCCAACGGTGG - Intronic
1007094345 6:39204109-39204131 GTCTCCTCGAAGACCAGAGCTGG + Intronic
1007933805 6:45715558-45715580 GTCTTCCCCAGTCACAGGGCTGG + Intergenic
1008539147 6:52531504-52531526 TCCTCCTCCAGGCCCAGAACAGG - Intronic
1016915992 6:149244852-149244874 GTCTCCTGCAGTCCCCAGGCTGG - Intronic
1018743092 6:166744878-166744900 GTAGACTCCATTCCCAGAGCCGG - Intronic
1019114890 6:169751902-169751924 GTCGCCTCCTGGCCCTGAGCTGG + Intronic
1022557141 7:31309670-31309692 GCCTCCCCCAGTCACAGAGCTGG - Intergenic
1023835171 7:44063695-44063717 GCCTCCTGCAGCCCCTGAGCTGG + Intronic
1023904652 7:44513613-44513635 TTCTGCTCCAGTGCCAGAGCCGG + Exonic
1023939238 7:44759469-44759491 GGCTCCTCCAGGCCCTGTGCCGG + Intronic
1024326260 7:48111477-48111499 CCCTCCTCCATTCCCAGCGCTGG + Intergenic
1025190661 7:56893304-56893326 TTGGCCTCCAGTGCCAGAGCAGG + Intergenic
1025681282 7:63683620-63683642 TTGGCCTCCAGTGCCAGAGCAGG - Intergenic
1026661881 7:72309693-72309715 GTCGTCTCCTGTCCCACAGCCGG + Intronic
1026942248 7:74293835-74293857 GCCTCCTCCTGTCCCGGGGCAGG - Intronic
1026994326 7:74606022-74606044 GTCCCATCCATGCCCAGAGCTGG + Intergenic
1028105117 7:86867886-86867908 GTCCCCTCTGCTCCCAGAGCTGG - Intergenic
1029456136 7:100673525-100673547 ACCTCCTCCAGTCCCAGAGGGGG + Exonic
1029530578 7:101122530-101122552 GTCTCCATCTGTCCCTGAGCAGG - Intergenic
1034225047 7:149475219-149475241 GTCTCCTCCTGGGCCACAGCAGG + Exonic
1034753899 7:153596440-153596462 CTCTTCTCCATCCCCAGAGCCGG + Intergenic
1035236136 7:157498721-157498743 GTCTTCACCAGGCCCAGAGCTGG - Intergenic
1035361743 7:158318062-158318084 GCCGCCTCCTGTCCGAGAGCCGG + Intronic
1037815915 8:22111818-22111840 GTGTCCTCCAGTCACAGAGAGGG + Intergenic
1038679806 8:29656247-29656269 GTCCCCTCCTTGCCCAGAGCAGG - Intergenic
1039768914 8:40662927-40662949 GTCTCCTCCAGGCCCTCAGCAGG + Intronic
1039902660 8:41764524-41764546 GGCTCATCCATTCCCAGATCAGG + Intronic
1040984602 8:53280072-53280094 CAACCCTCCAGTCCCAGAGCTGG - Intergenic
1041347054 8:56910257-56910279 TGGTCCTCCAGCCCCAGAGCAGG - Intergenic
1044930887 8:97250901-97250923 GTCTCCTCAAGCCCAAGAGAGGG + Intergenic
1045981003 8:108187270-108187292 GTTTCCTTCTGTCCCTGAGCGGG + Intergenic
1047611026 8:126521059-126521081 GTCTCCTACACTGCCCGAGCTGG + Intergenic
1047734292 8:127752171-127752193 GTCTCCCCCTCTCCCATAGCAGG - Intergenic
1048229147 8:132620191-132620213 GTCTCCTCCAGCCACACAGGAGG + Intronic
1048300319 8:133246402-133246424 GATTCCTGCAGTCCCAGAGAAGG + Intronic
1048369745 8:133767024-133767046 CTCTTCTTCAGTCCCTGAGCAGG - Intergenic
1048412282 8:134187596-134187618 GTCTGCTCCAGTCCCACAGAAGG + Intergenic
1048923696 8:139252379-139252401 GTCCCCTCCAGTCCCTGCTCAGG + Intergenic
1049197321 8:141322913-141322935 ATCTCCCCCAGTCACAGACCGGG - Intergenic
1049300126 8:141865287-141865309 GTCTCCTCCAGTCTCAGGCTCGG - Intergenic
1049419970 8:142512083-142512105 GTCTCCCACAGTGCCAGAGCCGG + Intronic
1049606070 8:143529745-143529767 GCTTCCCCCAGCCCCAGAGCAGG - Intronic
1049646658 8:143738714-143738736 GGCTCCCCCGGTCCCACAGCTGG + Intergenic
1050886289 9:10770338-10770360 CTCTCCCCCAGTCCCAGGACAGG - Intergenic
1053752293 9:41269099-41269121 GGCTCCTCCTCTGCCAGAGCTGG + Intergenic
1053787025 9:41659423-41659445 GCCTCCTCCAGCACCAGAGAGGG + Intergenic
1054158035 9:61654764-61654786 GCCTCCTCCAGCACCAGAGAGGG - Intergenic
1054257819 9:62833431-62833453 GGCTCCTCCTCTGCCAGAGCTGG + Intergenic
1054477808 9:65585769-65585791 GCCTCCTCCAGCACCAGAGAGGG - Intergenic
1055046081 9:71925555-71925577 GTCTCCTCCAGCTTCAGAGAAGG - Intronic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056707507 9:88964757-88964779 GTCCCCTTCAGCCCCAGAGAAGG + Intergenic
1057310772 9:93941719-93941741 CCCTCCTCCAGCCCCAGAGTAGG + Intergenic
1058879537 9:109274438-109274460 CTCTCCTCCAGACCCACAGAGGG + Intronic
1058932156 9:109731920-109731942 TTCTGCTCCAGCCACAGAGCTGG + Intronic
1059420000 9:114184935-114184957 GGCTCCACTGGTCCCAGAGCAGG - Intronic
1059423233 9:114205692-114205714 GGGTCCCCCAGACCCAGAGCTGG + Intronic
1060231316 9:121827455-121827477 CTGGGCTCCAGTCCCAGAGCTGG - Intronic
1061127089 9:128683953-128683975 GTCTCCTCCGGTCCCAGAGCAGG - Exonic
1062068369 9:134540945-134540967 GTCTGGACCAGTTCCAGAGCCGG + Intergenic
1062100343 9:134724784-134724806 GACTCCTCCTGGCCCAGAGAGGG + Intronic
1062217563 9:135397489-135397511 GGCTCCACCAGGCCCAGAGGAGG - Intergenic
1062264670 9:135681589-135681611 GCCTTCTCCAATCCCCGAGCCGG + Intergenic
1062428396 9:136516464-136516486 GTTTCCATCTGTCCCAGAGCTGG - Intronic
1062478957 9:136742730-136742752 GCCTGCTCCAGCTCCAGAGCCGG + Intronic
1203733779 Un_GL000216v2:116213-116235 CTTGCCCCCAGTCCCAGAGCTGG - Intergenic
1203660959 Un_KI270753v1:42555-42577 GCCTCCGCCAGCCCCAGAGAAGG - Intergenic
1203672140 Un_KI270755v1:25764-25786 GCCTCCGCCAGCCCCAGAGAAGG - Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187997719 X:24946516-24946538 TTCTTCACCAGTCCCTGAGCAGG + Intronic
1190064268 X:47229586-47229608 CTCTCCTGCAGTCCCGTAGCTGG + Exonic
1190820294 X:53966962-53966984 GTCTCCTCCCTTCCCAGATGGGG - Intronic
1191101060 X:56729257-56729279 GTCCCCTCCAGGCACAGAGCTGG - Intergenic
1193700522 X:84755193-84755215 GTCTCCTCCGGTCCCAGAGCAGG - Intergenic
1194035292 X:88863815-88863837 GCCTCGTCCAGCCCCAGAGAGGG - Intergenic
1195334892 X:103842758-103842780 TTCTCCTCCAGTCCCCTAACTGG - Intergenic
1196710134 X:118753828-118753850 GTCATATACAGTCCCAGAGCTGG + Intronic
1198518098 X:137428327-137428349 GTCTCTTCAAGGCGCAGAGCGGG - Intergenic
1198703831 X:139425802-139425824 TTCTCCCCAAGGCCCAGAGCAGG - Intergenic
1199182362 X:144873344-144873366 GCCTCAGCTAGTCCCAGAGCTGG - Intergenic
1199807418 X:151314138-151314160 GGCTATTCCAGACCCAGAGCTGG - Intergenic
1202627234 Y:56872208-56872230 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic